Transcript: Mouse NM_001163035.1

Mus musculus enolase-phosphatase 1 (Enoph1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Enoph1 (67870)
Length:
1490
CDS:
226..999

Additional Resources:

NCBI RefSeq record:
NM_001163035.1
NBCI Gene record:
Enoph1 (67870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081275 CCGATTGCTTTCGTGAAGGAT pLKO.1 292 CDS 100% 3.000 4.200 N Enoph1 n/a
2 TRCN0000081276 CATCGGTTGTTCAACCAACAA pLKO.1 813 CDS 100% 0.495 0.693 N Enoph1 n/a
3 TRCN0000081274 CGACGAGAAGACATACTACAA pLKO.1 936 CDS 100% 4.950 3.960 N Enoph1 n/a
4 TRCN0000288490 CGACGAGAAGACATACTACAA pLKO_005 936 CDS 100% 4.950 3.960 N Enoph1 n/a
5 TRCN0000081277 CGGTTGTTCAACCAACAACAT pLKO.1 816 CDS 100% 0.495 0.396 N Enoph1 n/a
6 TRCN0000348927 CACCGTAATCCTGTTAGATAT pLKO_005 255 CDS 100% 13.200 9.240 N Enoph1 n/a
7 TRCN0000348926 AGCTCATCGACGGTCACTTTG pLKO_005 737 CDS 100% 10.800 7.560 N Enoph1 n/a
8 TRCN0000348861 GAAAGACCACAGCGCTCAAAC pLKO_005 530 CDS 100% 10.800 7.560 N Enoph1 n/a
9 TRCN0000082749 GCAGAGTTCTTTGCAGATGTA pLKO.1 601 CDS 100% 4.950 3.465 N ENOPH1 n/a
10 TRCN0000307207 GCAGAGTTCTTTGCAGATGTA pLKO_005 601 CDS 100% 4.950 3.465 N ENOPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03859 pDONR223 100% 84.4% 93.1% None (many diffs) n/a
2 ccsbBroad304_03859 pLX_304 0% 84.4% 93.1% V5 (many diffs) n/a
3 TRCN0000476876 ATCCCTTATATTTGTTTGCCTTCA pLX_317 49.3% 84.4% 93.1% V5 (many diffs) n/a
4 TRCN0000488524 CCTTAAATTATGCCTCCGCCGCCC pLX_317 100% 37.6% 42.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV