Transcript: Human NM_001163437.3

Homo sapiens TBC1 domain containing kinase (TBCK), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
TBCK (93627)
Length:
7844
CDS:
309..2873

Additional Resources:

NCBI RefSeq record:
NM_001163437.3
NBCI Gene record:
TBCK (93627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149188 ATCAGGATGAGACACTACCC pXPR_003 AGG 1489 58% 17 1.3059 TBCK TBCK 75567
2 BRDN0001147900 TCTTATGAGAGGTTTAACCT pXPR_003 GGG 1306 51% 15 0.7206 TBCK TBCK 75564
3 BRDN0001149038 CAAACATGGTATAGTACACA pXPR_003 GGG 340 13% 4 0.4565 TBCK TBCK 75566
4 BRDN0001148062 TCCCTGTGCAATTACCTCAG pXPR_003 GGG 478 19% 6 0.4291 TBCK TBCK 75565
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001163437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196356 GCTAAAGGCTTATCCATATAA pLKO.1 1535 CDS 100% 15.000 21.000 N TBCK n/a
2 TRCN0000226445 GCTAAAGGCTTATCCATATAA pLKO_005 1535 CDS 100% 15.000 21.000 N TBCK n/a
3 TRCN0000226446 AGAAGTTCGGCACCTTATTTC pLKO_005 2370 CDS 100% 13.200 18.480 N TBCK n/a
4 TRCN0000218128 CAAGTACGATGCAATTGATAA pLKO_005 1655 CDS 100% 13.200 18.480 N TBCK n/a
5 TRCN0000377214 GGGCGCTTTCAAATCCTTAAA pLKO_005 426 CDS 100% 13.200 18.480 N TBCK n/a
6 TRCN0000367482 AGATTGTTGCATTTCCGTAAA pLKO_005 2970 3UTR 100% 10.800 15.120 N TBCK n/a
7 TRCN0000226447 CAGTGAAATCTGATCATATAT pLKO_005 3090 3UTR 100% 15.000 12.000 N TBCK n/a
8 TRCN0000007080 CGGAATAGTGAAGACTTTATT pLKO.1 2589 CDS 100% 15.000 12.000 N TBCK n/a
9 TRCN0000367607 CTGCCAGTATGTGGATATTTC pLKO_005 467 CDS 100% 13.200 10.560 N TBCK n/a
10 TRCN0000197039 GCTGAACATTGTGAACGTAGT pLKO.1 519 CDS 100% 4.050 3.240 N TBCK n/a
11 TRCN0000007081 CCATCCCATCTCCTCAAATAT pLKO.1 2851 CDS 100% 15.000 10.500 N TBCK n/a
12 TRCN0000194758 CCTCATTCAAACAGCAATAAT pLKO.1 1425 CDS 100% 15.000 10.500 N TBCK n/a
13 TRCN0000367448 GACAAATTGAAGTGGATATTC pLKO_005 1699 CDS 100% 13.200 9.240 N TBCK n/a
14 TRCN0000007078 GCATGGTTGTTTGGACATTAT pLKO.1 887 CDS 100% 13.200 9.240 N TBCK n/a
15 TRCN0000195579 GCCACATAAAGCCCAAGAAAT pLKO.1 3123 3UTR 100% 13.200 9.240 N TBCK n/a
16 TRCN0000226444 GGATACAGAGTACCAACTAAA pLKO_005 1490 CDS 100% 13.200 9.240 N TBCK n/a
17 TRCN0000367378 TTTACCACACTGCCACATAAA pLKO_005 3112 3UTR 100% 13.200 9.240 N TBCK n/a
18 TRCN0000194737 CCAGTCTAATTTACCTCATTC pLKO.1 1412 CDS 100% 10.800 7.560 N TBCK n/a
19 TRCN0000197111 GCAAGGTCTTGACTCACTTTG pLKO.1 1826 CDS 100% 10.800 7.560 N TBCK n/a
20 TRCN0000007079 CCAGCTAAGAAATAGATTGAA pLKO.1 1349 CDS 100% 5.625 3.938 N TBCK n/a
21 TRCN0000007077 GCAAGAAACTTGACTCTACAT pLKO.1 3045 3UTR 100% 4.950 3.465 N TBCK n/a
22 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5686 3UTR 100% 4.950 2.475 Y KAAG1 n/a
23 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 4150 3UTR 100% 4.950 2.475 Y NLRP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04607 pDONR223 100% 99.9% 99.8% None 679C>G n/a
2 ccsbBroad304_04607 pLX_304 0% 99.9% 99.8% V5 679C>G n/a
3 TRCN0000465987 CAAGAGCCGTGAGACGTTCAGATC pLX_317 15.4% 99.9% 99.8% V5 679C>G n/a
4 ccsbBroadEn_04606 pDONR223 100% 94.6% 88.3% None (many diffs) n/a
5 ccsbBroad304_04606 pLX_304 0% 94.6% 88.3% V5 (many diffs) n/a
6 TRCN0000480238 GGGTTTGGCTTAGTACCATGTGCC pLX_317 17.7% 94.6% 88.3% V5 (many diffs) n/a
7 ccsbBroadEn_15218 pDONR223 0% 94.6% 88.3% None (many diffs) n/a
8 ccsbBroad304_15218 pLX_304 0% 94.6% 88.3% V5 (many diffs) n/a
Download CSV