Transcript: Mouse NM_001164311.1

Mus musculus lysyl oxidase-like 4 (Loxl4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Loxl4 (67573)
Length:
5447
CDS:
106..2382

Additional Resources:

NCBI RefSeq record:
NM_001164311.1
NBCI Gene record:
Loxl4 (67573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076704 GCTGGACAATGTTCGTTGTTT pLKO.1 396 CDS 100% 5.625 7.875 N Loxl4 n/a
2 TRCN0000076706 CCTAGATCAGTGTGGCTCTAA pLKO.1 432 CDS 100% 4.950 3.465 N Loxl4 n/a
3 TRCN0000222678 GAAGTGGTGATGAGTGGAGTT pLKO.1 1576 CDS 100% 4.050 2.835 N Loxl4 n/a
4 TRCN0000076705 GCTTCTGTCTAGAAGATACAA pLKO.1 2030 CDS 100% 0.563 0.394 N Loxl4 n/a
5 TRCN0000076703 GCACGGTGTGTGATGATGATT pLKO.1 272 CDS 100% 5.625 3.938 N Loxl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09154 pDONR223 100% 85.5% 86.4% None (many diffs) n/a
2 ccsbBroad304_09154 pLX_304 0% 85.5% 86.4% V5 (many diffs) n/a
3 TRCN0000481341 AACTGTATACCACTCGCTCGTCGG pLX_317 20% 85.5% 86.4% V5 (many diffs) n/a
4 ccsbBroadEn_12788 pDONR223 100% 30.5% 31.7% None (many diffs) n/a
5 ccsbBroad304_12788 pLX_304 0% 30.5% 31.7% V5 (many diffs) n/a
6 TRCN0000474433 TCCAATTATTAGAGTGCACCGCAG pLX_317 49.8% 30.5% 31.7% V5 (many diffs) n/a
Download CSV