Transcript: Human NM_001164382.1

Homo sapiens staufen double-stranded RNA binding protein 2 (STAU2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
STAU2 (27067)
Length:
2888
CDS:
363..1877

Additional Resources:

NCBI RefSeq record:
NM_001164382.1
NBCI Gene record:
STAU2 (27067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153783 CCCAAAGATATGAACCAACCT pLKO.1 1371 CDS 100% 2.640 2.112 N STAU2 n/a
2 TRCN0000219963 TACAGGAACAGGACCTAATAA pLKO.1 1103 CDS 100% 15.000 10.500 N STAU2 n/a
3 TRCN0000219962 ATTAGCCGCCTGGCGCAAATT pLKO.1 975 CDS 100% 13.200 9.240 N STAU2 n/a
4 TRCN0000102357 CCAACCTTCAAGCTCTTTCTT pLKO.1 1385 CDS 100% 5.625 3.938 N Stau2 n/a
5 TRCN0000178809 CCAACCTTCAAGCTCTTTCTT pLKO.1 1385 CDS 100% 5.625 3.938 N STAU2 n/a
6 TRCN0000308893 CCAACCTTCAAGCTCTTTCTT pLKO_005 1385 CDS 100% 5.625 3.938 N Stau2 n/a
7 TRCN0000102356 GCCAGGGAACTCCTTATGAAT pLKO.1 1443 CDS 100% 5.625 3.938 N Stau2 n/a
8 TRCN0000157149 GCCAGGGAACTCCTTATGAAT pLKO.1 1443 CDS 100% 5.625 3.938 N STAU2 n/a
9 TRCN0000308892 GCCAGGGAACTCCTTATGAAT pLKO_005 1443 CDS 100% 5.625 3.938 N Stau2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08049 pDONR223 100% 80.8% None 0_1ins216;280G>A;1215_1328del n/a
2 ccsbBroad304_08049 pLX_304 0% 80.8% V5 (not translated due to prior stop codon) 0_1ins216;280G>A;1215_1328del n/a
3 TRCN0000481145 GGGAGCCGCTTTGCGACGCCCTTG pLX_317 26.1% 80.8% V5 (not translated due to prior stop codon) 0_1ins216;280G>A;1215_1328del n/a
4 ccsbBroadEn_08050 pDONR223 100% 70.5% 70.4% None 0_1ins216;280G>A;1221_1512delinsA n/a
5 ccsbBroad304_08050 pLX_304 0% 70.5% 70.4% V5 0_1ins216;280G>A;1221_1512delinsA n/a
6 TRCN0000467416 TGAACAATCTGTCTGGCTTTCACA pLX_317 21.2% 70.5% 70.4% V5 0_1ins216;280G>A;1221_1512delinsA n/a
Download CSV