Transcript: Mouse NM_001164733.1

Mus musculus membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) (Mpp6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mpp6 (56524)
Length:
2212
CDS:
283..1944

Additional Resources:

NCBI RefSeq record:
NM_001164733.1
NBCI Gene record:
Mpp6 (56524)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024305 GCCATCCGTATTCTCGGTATT pLKO.1 658 CDS 100% 10.800 15.120 N Mpp6 n/a
2 TRCN0000024307 GCATACAACCACTACTTTGAT pLKO.1 1816 CDS 100% 5.625 7.875 N Mpp6 n/a
3 TRCN0000024306 GCAGAGGAGATAGACCTAATT pLKO.1 331 CDS 100% 13.200 10.560 N Mpp6 n/a
4 TRCN0000368768 TTCACGTGGGAGATATCATTA pLKO_005 785 CDS 100% 13.200 10.560 N Mpp6 n/a
5 TRCN0000361744 CAGAGATGGAAGCAGATATTA pLKO_005 1499 CDS 100% 15.000 10.500 N Mpp6 n/a
6 TRCN0000361747 GTACTGAATCCTGCTAGATTT pLKO_005 1399 CDS 100% 13.200 9.240 N Mpp6 n/a
7 TRCN0000024308 CCTCTGATTAGTGTGGATGAA pLKO.1 487 CDS 100% 4.950 3.465 N Mpp6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489158 ACGGGAGACCATCTCCGGCAAGCG pLX_317 23.5% 88.2% 95.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489366 GCTCAAATGCGGCGGACAGGTGTC pLX_317 21.6% 88.1% 95.4% V5 (many diffs) n/a
3 TRCN0000474714 TCGAAACATACATTCCTTTGAAAG pLX_317 100% 22.4% 1.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV