Construct: ORF TRCN0000489366
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019103.1_s317c1
- DNA Barcode:
- GCTCAAATGCGGCGGACAGGTGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPP6 (51678)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489366
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51678 | MPP6 | membrane palmitoylated prot... | NM_001303037.2 | 99.8% | 99.8% | 741G>A;1620_1621insG |
| 2 | human | 51678 | MPP6 | membrane palmitoylated prot... | NM_016447.4 | 99.8% | 99.8% | 741G>A;1620_1621insG |
| 3 | human | 51678 | MPP6 | membrane palmitoylated prot... | XM_006715738.3 | 99.8% | 99.8% | 741G>A;1620_1621insG |
| 4 | human | 51678 | MPP6 | membrane palmitoylated prot... | XM_006715739.3 | 99.8% | 99.8% | 741G>A;1620_1621insG |
| 5 | human | 51678 | MPP6 | membrane palmitoylated prot... | XM_006715740.3 | 99.8% | 99.8% | 741G>A;1620_1621insG |
| 6 | human | 51678 | MPP6 | membrane palmitoylated prot... | XM_011515425.2 | 99.8% | 99.8% | 741G>A;1620_1621insG |
| 7 | human | 51678 | MPP6 | membrane palmitoylated prot... | XM_017012315.1 | 99.8% | 99.8% | 741G>A;1620_1621insG |
| 8 | human | 51678 | MPP6 | membrane palmitoylated prot... | XM_017012316.2 | 99.8% | 99.8% | 741G>A;1620_1621insG |
| 9 | human | 51678 | MPP6 | membrane palmitoylated prot... | XM_017012317.1 | 99.8% | 99.8% | 741G>A;1620_1621insG |
| 10 | human | 51678 | MPP6 | membrane palmitoylated prot... | XM_005249775.5 | 79.1% | 79.1% | 0_1ins336;405G>A;1284_1285insG |
| 11 | mouse | 56524 | Mpp6 | membrane protein, palmitoyl... | NM_019939.2 | 90.4% | 97.9% | (many diffs) |
| 12 | mouse | 56524 | Mpp6 | membrane protein, palmitoyl... | NM_001164733.1 | 88.1% | 95.4% | (many diffs) |
| 13 | mouse | 56524 | Mpp6 | membrane protein, palmitoyl... | NM_001164734.1 | 88.1% | 95.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1695
- ORF length:
- 1623
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcagcaa gtcttggaaa accttacgga gctgccctcg tctactggag 121 cagaagaaat agacctaatt ttcctcaagg gaattatgga gaatcctatt gtaaaatcac 181 ttgctaaggc tcatgagagg ctagaagatt ccaaactaga agctgtcagt gacaataact 241 tggaattagt caatgaaatt cttgaagaca tcactcctct aataaatgtg gatgaaaatg 301 tggcagaatt ggttggtata ctcaaagaac ctcacttcca gtcactgttg gaggcccatg 361 atattgtggc atcaaagtgt tatgattcac ctccatcaag cccagaaatg aataattctt 421 ctatcaataa tcagttatta ccagtagatg ccattcgtat tcttggtatt cacaaaagag 481 ctggggaacc actgggtgtg acatttaggg ttgaaaataa tgatctggta attgcccgaa 541 tcctccatgg gggaatgata gatcgacaag gtctacttca tgtgggagat ataattaaag 601 aagtcaatgg ccatgaggtt ggaaataatc caaaggaatt acaagaatta ctgaaaaata 661 ttagtggaag tgtcacccta aaaatcttac caagttatag agataccatt actcctcaac 721 aggtatttgt gaagtgtcat tttgattata atccatacaa tgacaaccta ataccttgca 781 aagaagcagg attgaagttt tccaaaggag aaattcttca gattgtaaat agagaagatc 841 caaattggtg gcaggctagc catgtaaaag agggaggaag cgctggtctc attccaagcc 901 agttcctgga agagaagaga aaggcatttg ttagaagaga ctgggacaat tcaggacctt 961 tttgtggaac tataagtagc aaaaaaaaga aaaagatgat gtatctcaca accagaaatg 1021 cagaatttga tcgtcatgaa atccagatat atgaggaggt agccaaaatg cctcccttcc 1081 agagaaaaac attagtattg ataggagctc aaggtgtagg ccgaagaagc ttgaaaaaca 1141 ggttcatagt attgaatccc actagatttg gaactacggt gccatttact tcacggaaac 1201 caagggaaga tgaaaaagat ggccaggcat ataagtttgt gtcacgatct gagatggaag 1261 cagatattaa agctggaaag tatttggaac atggggaata tgaaggaaat ctctatggaa 1321 ccaaaattga ttctattctt gaggttGTCC AAACTGGACG GACTTGCATT CTGGATGTCA 1381 ACCCACAAGC ACTGAAAGTA TTGAGGACAT CAGAGTTTAT GCCCTATGTG GTATTTATTG 1441 CGGCTCCGGA GCTAGAGACG TTACGTGCCA TGCACAAGGC TGTGGTGGAT GCAGGAATCA 1501 CTACCAAGCT TCTGACCGAC TCTGACTTGA AGAAAACAGT GGATGAAAGT GCACGGATTC 1561 AGAGAGCATA CAACCACTAT TTTGATTTGA TCATCATAAA TGATAATCTA GACAAAGCCT 1621 TTGAAAAACT GCAAACTGCC ATAGAGAAAC TGAGAATGGA ACCACAGTGG GTCCCAATCA 1681 GCTGGGTTTA CGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1741 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1801 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGCT CAAATGCGGC GGACAGGTGT 1861 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t