Transcript: Human NM_001164774.2

Homo sapiens ataxin 3 (ATXN3), transcript variant b, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
ATXN3 (4287)
Length:
6201
CDS:
31..297

Additional Resources:

NCBI RefSeq record:
NM_001164774.2
NBCI Gene record:
ATXN3 (4287)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164774.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007405 CGTCGGTTGTAGGACTAAATA pLKO.1 583 3UTR 100% 15.000 10.500 N ATXN3 n/a
2 TRCN0000412482 GCAGCTGTGACCATGTCTTTA pLKO_005 371 3UTR 100% 13.200 9.240 N ATXN3 n/a
3 TRCN0000007409 GTGCTCAACATTGCCTGAATA pLKO.1 71 CDS 100% 13.200 9.240 N ATXN3 n/a
4 TRCN0000433180 ATGTCTAAAGTTAGGGCATTT pLKO_005 706 3UTR 100% 10.800 7.560 N ATXN3 n/a
5 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 4576 3UTR 100% 4.950 2.475 Y GJD4 n/a
6 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 4576 3UTR 100% 4.950 2.475 Y C9orf85 n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2734 3UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2734 3UTR 100% 1.080 0.540 Y MYORG n/a
9 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3906 3UTR 100% 10.800 5.400 Y SMIM11A n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5172 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5172 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164774.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13896 pDONR223 100% 21.6% 17.6% None (many diffs) n/a
2 ccsbBroad304_13896 pLX_304 0% 21.6% 17.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470627 AGGGTCAACTTGCCCGAATTCAAC pLX_317 41.5% 21.6% 17.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV