Transcript: Mouse NM_001166030.1

Mus musculus myosin light chain kinase family, member 4 (Mylk4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mylk4 (238564)
Length:
5641
CDS:
64..1227

Additional Resources:

NCBI RefSeq record:
NM_001166030.1
NBCI Gene record:
Mylk4 (238564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432402 ATTTGATCATCGGATGGTAAT pLKO_005 327 CDS 100% 10.800 15.120 N Mylk4 n/a
2 TRCN0000432724 ATCCATGAAAGGAGCCTATTC pLKO_005 1227 CDS 100% 10.800 8.640 N Mylk4 n/a
3 TRCN0000024415 GCACTAGATGAAAGGATAATT pLKO.1 250 CDS 100% 15.000 10.500 N Mylk4 n/a
4 TRCN0000024418 CATTAAGACTAGAGGTGCAAA pLKO.1 474 CDS 100% 4.950 3.465 N Mylk4 n/a
5 TRCN0000037448 GTGTGTGAATCGGGATGCTAA pLKO.1 768 CDS 100% 4.950 3.465 N MYLK4 n/a
6 TRCN0000024416 CCAGATGTACATCCTCCACTT pLKO.1 723 CDS 100% 4.050 2.835 N Mylk4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10023 pDONR223 100% 83.2% 84.8% None (many diffs) n/a
2 ccsbBroad304_10023 pLX_304 0% 83.2% 84.8% V5 (many diffs) n/a
3 TRCN0000468726 CAAAGAGTATTCCATGTAGACAAG pLX_317 32.2% 83.2% 84.8% V5 (many diffs) n/a
Download CSV