Transcript: Human NM_001166550.4

Homo sapiens iduronate 2-sulfatase (IDS), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
IDS (3423)
Length:
7536
CDS:
396..1778

Additional Resources:

NCBI RefSeq record:
NM_001166550.4
NBCI Gene record:
IDS (3423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296558 ATACCGATGATTCTCCGTATA pLKO_005 559 CDS 100% 10.800 15.120 N IDS n/a
2 TRCN0000051544 CCCGTGAACTGATTGCCTATA pLKO.1 1495 CDS 100% 10.800 15.120 N IDS n/a
3 TRCN0000296610 ATATCTTATGAGCCCTATATA pLKO_005 2236 3UTR 100% 15.000 12.000 N IDS n/a
4 TRCN0000051543 GCAGGATCACAATATGTATAA pLKO.1 1715 CDS 100% 13.200 9.240 N IDS n/a
5 TRCN0000290295 GCAGGATCACAATATGTATAA pLKO_005 1715 CDS 100% 13.200 9.240 N IDS n/a
6 TRCN0000051546 CCTCTGTGTCATATTTGGATA pLKO.1 1030 CDS 100% 4.950 3.465 N IDS n/a
7 TRCN0000290296 CCTCTGTGTCATATTTGGATA pLKO_005 1030 CDS 100% 4.950 3.465 N IDS n/a
8 TRCN0000051547 GATATAAAGATCATGGGCTAT pLKO.1 1575 CDS 100% 4.050 2.835 N IDS n/a
9 TRCN0000051545 CCTGTACGACTTCAACTCCTA pLKO.1 428 CDS 100% 2.640 1.848 N IDS n/a
10 TRCN0000290367 CCTGTACGACTTCAACTCCTA pLKO_005 428 CDS 100% 2.640 1.848 N IDS n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3764 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3764 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5228 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5229 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3762 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3762 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3762 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10899 pDONR223 100% 39.3% 35.9% None (many diffs) n/a
2 ccsbBroad304_10899 pLX_304 0% 39.3% 35.9% V5 (many diffs) n/a
3 TRCN0000466249 TATAGTCATACGTCTCGCGCGTCA pLX_317 28.9% 39.3% 35.9% V5 (many diffs) n/a
Download CSV