Transcript: Human NM_001170569.1

Homo sapiens chromosome X open reading frame 56 (CXorf56), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-13
Taxon:
Homo sapiens (human)
Gene:
CXorf56 (63932)
Length:
2408
CDS:
309..830

Additional Resources:

NCBI RefSeq record:
NM_001170569.1
NBCI Gene record:
CXorf56 (63932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170569.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420298 CATAGACGGATTCCTATTTAT pLKO_005 901 3UTR 100% 15.000 10.500 N CXorf56 n/a
2 TRCN0000430877 GGCAAAGTAATTTCTTGATTA pLKO_005 880 3UTR 100% 13.200 9.240 N CXorf56 n/a
3 TRCN0000414248 TACGTTGTTTCCCATTGATTC pLKO_005 939 3UTR 100% 10.800 6.480 N CXorf56 n/a
4 TRCN0000168073 CGTGTCTACCATTGATGAAGA pLKO.1 635 CDS 100% 4.950 2.970 N CXorf56 n/a
5 TRCN0000168623 GCATTTAGATCAGGAGGCAAA pLKO.1 865 3UTR 100% 4.050 2.430 N CXorf56 n/a
6 TRCN0000167919 CCTGTTACCTTCATTGTGGAT pLKO.1 489 CDS 100% 2.640 1.584 N CXorf56 n/a
7 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1919 3UTR 100% 4.950 2.475 Y ORAI2 n/a
8 TRCN0000167207 CTTGATTGACAACCAGTTCAA pLKO.1 806 CDS 100% 4.950 2.475 Y CXorf56 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1265 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1916 3UTR 100% 4.950 2.475 Y LOC339059 n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2009 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1265 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170569.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08818 pDONR223 100% 77.7% 77.9% None 0_1ins147;228C>T n/a
2 ccsbBroad304_08818 pLX_304 0% 77.7% 77.9% V5 0_1ins147;228C>T n/a
3 TRCN0000480783 GGCGCCCTCACTTTTCACATATCA pLX_317 59.9% 77.7% 77.9% V5 0_1ins147;228C>T n/a
Download CSV