Transcript: Human NM_001170570.2

Homo sapiens chromosome X open reading frame 56 (CXorf56), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CXorf56 (63932)
Length:
2259
CDS:
55..681

Additional Resources:

NCBI RefSeq record:
NM_001170570.2
NBCI Gene record:
CXorf56 (63932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170570.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420298 CATAGACGGATTCCTATTTAT pLKO_005 752 3UTR 100% 15.000 10.500 N CXorf56 n/a
2 TRCN0000430877 GGCAAAGTAATTTCTTGATTA pLKO_005 731 3UTR 100% 13.200 9.240 N CXorf56 n/a
3 TRCN0000414248 TACGTTGTTTCCCATTGATTC pLKO_005 790 3UTR 100% 10.800 6.480 N CXorf56 n/a
4 TRCN0000168073 CGTGTCTACCATTGATGAAGA pLKO.1 486 CDS 100% 4.950 2.970 N CXorf56 n/a
5 TRCN0000168623 GCATTTAGATCAGGAGGCAAA pLKO.1 716 3UTR 100% 4.050 2.430 N CXorf56 n/a
6 TRCN0000167919 CCTGTTACCTTCATTGTGGAT pLKO.1 340 CDS 100% 2.640 1.584 N CXorf56 n/a
7 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1770 3UTR 100% 4.950 2.475 Y ORAI2 n/a
8 TRCN0000167207 CTTGATTGACAACCAGTTCAA pLKO.1 657 CDS 100% 4.950 2.475 Y CXorf56 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1116 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1767 3UTR 100% 4.950 2.475 Y LOC339059 n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1860 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1116 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170570.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08818 pDONR223 100% 93.5% 93.6% None 242_243ins42;333C>T n/a
2 ccsbBroad304_08818 pLX_304 0% 93.5% 93.6% V5 242_243ins42;333C>T n/a
3 TRCN0000480783 GGCGCCCTCACTTTTCACATATCA pLX_317 59.9% 93.5% 93.6% V5 242_243ins42;333C>T n/a
Download CSV