Transcript: Human NM_001170782.2

Homo sapiens family with sequence similarity 122C (FAM122C), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM122C (159091)
Length:
1875
CDS:
165..455

Additional Resources:

NCBI RefSeq record:
NM_001170782.2
NBCI Gene record:
FAM122C (159091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263942 TGTTGCAAGCTGACATGTTAA pLKO_005 289 CDS 100% 13.200 18.480 N FAM122C n/a
2 TRCN0000167650 GAATTAGGACAAACAGAACAA pLKO.1 310 CDS 100% 4.950 3.465 N FAM122C n/a
3 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1760 3UTR 100% 4.950 2.475 Y CFLAR n/a
4 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1760 3UTR 100% 4.950 2.475 Y C19orf31 n/a
5 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1758 3UTR 100% 4.950 2.475 Y ERN2 n/a
6 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1758 3UTR 100% 4.950 2.475 Y P3H4 n/a
7 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1758 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16111 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16111 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467347 CTTACCCTTGAAAATGTTCACGCA pLX_317 23.7% 100% 100% V5 n/a
4 ccsbBroadEn_05102 pDONR223 100% 52.2% 39.1% None (many diffs) n/a
5 TRCN0000478791 GTTGATACAACTCGAAATACACCT pLX_317 83.4% 52.2% 39.1% V5 (many diffs) n/a
6 ccsbBroadEn_05101 pDONR223 100% 41.2% 31.3% None (many diffs) n/a
7 ccsbBroad304_05101 pLX_304 0% 41.2% 31.3% V5 (many diffs) n/a
8 TRCN0000471934 AGGTCATATACCATCAGAGCGAAC pLX_317 64.9% 41.2% 31.3% V5 (many diffs) n/a
Download CSV