Transcript: Mouse NM_001172093.1

Mus musculus DEP domain containing 1a (Depdc1a), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Depdc1a (76131)
Length:
2502
CDS:
87..1676

Additional Resources:

NCBI RefSeq record:
NM_001172093.1
NBCI Gene record:
Depdc1a (76131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001172093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328643 AGTTTGGAGATACGTTATTAT pLKO_005 653 CDS 100% 15.000 21.000 N Depdc1a n/a
2 TRCN0000215836 CCAAGTAATTCCTCAATATAT pLKO.1 731 CDS 100% 15.000 21.000 N Depdc1a n/a
3 TRCN0000183808 CCAAGAAGTAATGACACCAAT pLKO.1 861 CDS 100% 4.950 6.930 N Depdc1a n/a
4 TRCN0000328646 CCTGCAACTTCTCCACTTAAA pLKO_005 405 CDS 100% 13.200 9.240 N Depdc1a n/a
5 TRCN0000183727 CGTCTGTGTCTATATGTATAT pLKO.1 1955 3UTR 100% 13.200 9.240 N Depdc1a n/a
6 TRCN0000328715 CGTCTGTGTCTATATGTATAT pLKO_005 1955 3UTR 100% 13.200 9.240 N Depdc1a n/a
7 TRCN0000180737 GCACCTGACAACCAAGAAATA pLKO.1 612 CDS 100% 13.200 9.240 N Depdc1a n/a
8 TRCN0000328645 TGATGACAACAATCAACTATT pLKO_005 377 CDS 100% 13.200 9.240 N Depdc1a n/a
9 TRCN0000183272 GCCAACATATTCTTACTGTAA pLKO.1 1385 CDS 100% 4.950 3.465 N Depdc1a n/a
10 TRCN0000183154 GCTAAAGAACTGGTTGTTTAA pLKO.1 1978 3UTR 100% 13.200 7.920 N Depdc1a n/a
11 TRCN0000328644 GCTAAAGAACTGGTTGTTTAA pLKO_005 1978 3UTR 100% 13.200 7.920 N Depdc1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03616 pDONR223 100% 87.2% 85.2% None (many diffs) n/a
2 ccsbBroad304_03616 pLX_304 0% 87.2% 85.2% V5 (many diffs) n/a
3 TRCN0000478893 GGCCGATATCCAGTCTGGGTCGCG pLX_317 24.1% 87.2% 85.2% V5 (many diffs) n/a
Download CSV