Transcript: Human NM_001173476.2

Homo sapiens striated muscle enriched protein kinase (SPEG), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
SPEG (10290)
Length:
1432
CDS:
293..634

Additional Resources:

NCBI RefSeq record:
NM_001173476.2
NBCI Gene record:
SPEG (10290)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001173476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037431 CTACACTTGCAAAGCGGTCAA pLKO.1 562 CDS 100% 4.050 5.670 N SPEG n/a
2 TRCN0000037432 GCGTGGCGATGCTGGTTTCTA pLKO.1 544 CDS 100% 1.875 2.625 N SPEG n/a
3 TRCN0000037429 CCACCTTCAAGGTCTCACTTA pLKO.1 351 CDS 100% 4.950 3.465 N SPEG n/a
4 TRCN0000037430 CCAAGATGTCATCATGAGCAT pLKO.1 394 CDS 100% 2.640 1.848 N SPEG n/a
5 TRCN0000037433 TCACTTATGGACCAGTCAGTA pLKO.1 365 CDS 100% 4.950 2.970 N SPEG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001173476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02387 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02387 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467901 AATAATGACTCCTACGGATTTTGC pLX_317 77.9% 100% 100% V5 n/a
4 TRCN0000488863 GAAACGTACAGGTATTCTTTTTCG pLX_317 59.5% 66.4% 66.4% V5 (not translated due to prior stop codon) 0_1ins171 n/a
5 TRCN0000488546 TAATCTTAGTTCATACATGCTTTC pLX_317 58.7% 66.3% 66% V5 0_1ins171;339_340insG n/a
Download CSV