Transcript: Human NM_001174098.1

Homo sapiens solute carrier family 29 member 3 (SLC29A3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
SLC29A3 (55315)
Length:
2283
CDS:
58..834

Additional Resources:

NCBI RefSeq record:
NM_001174098.1
NBCI Gene record:
SLC29A3 (55315)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001174098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043679 CTGTGGCACATACATCATCTT pLKO.1 207 CDS 100% 4.950 3.465 N SLC29A3 n/a
2 TRCN0000043680 CTTCTGTGTCACCTACGTCTT pLKO.1 990 3UTR 100% 4.050 2.835 N SLC29A3 n/a
3 TRCN0000043678 GCACAGTTCAAACTCCACCTA pLKO.1 87 CDS 100% 2.640 1.848 N SLC29A3 n/a
4 TRCN0000043682 CGTGGCCTCATTGGTGGACTT pLKO.1 696 CDS 100% 1.350 0.945 N SLC29A3 n/a
5 TRCN0000043681 CACCATTGTCTGCATGGTGAT pLKO.1 558 CDS 100% 0.405 0.284 N SLC29A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489869 AAACGACGTAGCTTTGGCACAGTG pLX_317 25.9% 54.3% 54.3% V5 (not translated due to prior stop codon) 774_775ins651 n/a
2 ccsbBroadEn_08514 pDONR223 100% 54.1% 53.8% None 473C>T;714_715delTGinsCA;774_775ins651 n/a
3 ccsbBroad304_08514 pLX_304 0% 54.1% 53.8% V5 473C>T;714_715delTGinsCA;774_775ins651 n/a
4 TRCN0000488790 AATCACGACGAATAACTTTTGCGT pLX_317 15.7% 54.1% 53.8% V5 (not translated due to prior stop codon) 473C>T;714_715delTGinsCA;774_775ins651 n/a
Download CSV