Transcript: Mouse NM_001177791.1

Mus musculus phosphatase and actin regulator 3 (Phactr3), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Phactr3 (74189)
Length:
4695
CDS:
45..1724

Additional Resources:

NCBI RefSeq record:
NM_001177791.1
NBCI Gene record:
Phactr3 (74189)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431962 TGATACCAACACTGAACATTC pLKO_005 1760 3UTR 100% 10.800 7.560 N PHACTR3 n/a
2 TRCN0000174447 CCTGAAACAAAGGAATGATCA pLKO.1 1421 CDS 100% 4.950 3.465 N Phactr3 n/a
3 TRCN0000174289 CAGGAAATGAATAAAGGCTTT pLKO.1 2265 3UTR 100% 4.050 2.835 N Phactr3 n/a
4 TRCN0000193633 CCTAGAAGGAACTTACTGGAA pLKO.1 2494 3UTR 100% 2.640 1.848 N Phactr3 n/a
5 TRCN0000176214 GAGGAACTGGAGAGAAGAAAT pLKO.1 1398 CDS 100% 13.200 7.920 N Phactr3 n/a
6 TRCN0000052691 GCAGCAGATAAGGCAGCAATT pLKO.1 1620 CDS 100% 10.800 6.480 N PHACTR3 n/a
7 TRCN0000425136 GACCCACTGTTGATGAATTAA pLKO_005 1501 CDS 100% 15.000 10.500 N PHACTR3 n/a
8 TRCN0000052688 GCTGTGTTTGTGAGAAGAGTA pLKO.1 1808 3UTR 100% 4.950 3.465 N PHACTR3 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3377 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04697 pDONR223 100% 82.1% 81.3% None (many diffs) n/a
2 ccsbBroad304_04697 pLX_304 0% 82.1% 81.3% V5 (many diffs) n/a
3 TRCN0000470159 CACGTGACTTTCCAAGATCCGTTG pLX_317 20.6% 82.1% 81.3% V5 (many diffs) n/a
Download CSV