Transcript: Mouse NM_001177806.1

Mus musculus eukaryotic translation initiation factor 2 alpha kinase 4 (Eif2ak4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Eif2ak4 (27103)
Length:
4916
CDS:
125..4735

Additional Resources:

NCBI RefSeq record:
NM_001177806.1
NBCI Gene record:
Eif2ak4 (27103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361611 CAAACTCGTCTGCGATGAAAT pLKO_005 4633 CDS 100% 13.200 18.480 N Eif2ak4 n/a
2 TRCN0000361612 GTTGGTGAAGTATAGCTTAAA pLKO_005 3643 CDS 100% 13.200 18.480 N Eif2ak4 n/a
3 TRCN0000028778 CCTCGGAAGTTAGACCGATTT pLKO.1 3218 CDS 100% 10.800 15.120 N Eif2ak4 n/a
4 TRCN0000028830 CGGTACTTCATTGAGTTTGAA pLKO.1 1538 CDS 100% 5.625 7.875 N Eif2ak4 n/a
5 TRCN0000235995 TCTGGATGGATTAGCTTATAT pLKO_005 2278 CDS 100% 15.000 12.000 N Eif2ak4 n/a
6 TRCN0000361610 CAAGTGGAACTGAGGGTTAAA pLKO_005 105 5UTR 100% 13.200 9.240 N Eif2ak4 n/a
7 TRCN0000235996 GACTACTACAGAATCCTATTT pLKO_005 4712 CDS 100% 13.200 9.240 N Eif2ak4 n/a
8 TRCN0000028842 GCCAACCATCAACTCACTAAT pLKO.1 3598 CDS 100% 13.200 9.240 N Eif2ak4 n/a
9 TRCN0000028779 CGAGAGATTCTGGATGGATTA pLKO.1 2270 CDS 100% 10.800 7.560 N Eif2ak4 n/a
10 TRCN0000235994 CTAAAGAACTGCTGCTGTATT pLKO_005 4738 3UTR 100% 13.200 7.920 N Eif2ak4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15327 pDONR223 0% 46.4% 49% None (many diffs) n/a
2 ccsbBroad304_15327 pLX_304 0% 46.4% 49% V5 (many diffs) n/a
3 TRCN0000468897 TAATAACTGCTATCGATAGTCCCA pLX_317 16.1% 46.4% 49% V5 (many diffs) n/a
4 ccsbBroadEn_14503 pDONR223 100% 46.3% 48.8% None (many diffs) n/a
5 ccsbBroad304_14503 pLX_304 0% 46.3% 48.8% V5 (many diffs) n/a
6 TRCN0000473863 TAATGGTTTCACAGGGAACGAGCC pLX_317 23% 46.3% 48.8% V5 (many diffs) n/a
7 ccsbBroadEn_13689 pDONR223 100% 26.1% 26.7% None (many diffs) n/a
8 ccsbBroad304_13689 pLX_304 0% 26.1% 26.7% V5 (many diffs) n/a
9 TRCN0000470577 TGGACCGTGATACTAATAGAACGA pLX_317 23.1% 26.1% 26.7% V5 (many diffs) n/a
Download CSV