Transcript: Human NM_001184700.2

Homo sapiens UDP-glucose 6-dehydrogenase (UGDH), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
UGDH (7358)
Length:
2836
CDS:
165..1448

Additional Resources:

NCBI RefSeq record:
NM_001184700.2
NBCI Gene record:
UGDH (7358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028108 CCGAAGTTTAGTCTTCAAGAT pLKO.1 1401 CDS 100% 4.950 6.930 N UGDH n/a
2 TRCN0000280945 CCGAAGTTTAGTCTTCAAGAT pLKO_005 1401 CDS 100% 4.950 6.930 N UGDH n/a
3 TRCN0000028076 CGGTTGTTGATGTCAATGAAT pLKO.1 262 CDS 100% 5.625 3.938 N UGDH n/a
4 TRCN0000280878 CGGTTGTTGATGTCAATGAAT pLKO_005 262 CDS 100% 5.625 3.938 N UGDH n/a
5 TRCN0000028112 GCCATCAAAGAAGCTGATCTT pLKO.1 396 CDS 100% 4.950 3.465 N UGDH n/a
6 TRCN0000280879 GCCATCAAAGAAGCTGATCTT pLKO_005 396 CDS 100% 4.950 3.465 N UGDH n/a
7 TRCN0000028039 CGGATCATAGATAGTCTGTTT pLKO.1 912 CDS 100% 4.950 2.970 N UGDH n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1800 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1729 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1668 3UTR 100% 2.640 1.320 Y LINC01098 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1800 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07118 pDONR223 100% 86.3% 1.1% None 30C>T;264_265ins201 n/a
2 ccsbBroad304_07118 pLX_304 0% 86.3% 1.1% V5 (not translated due to prior stop codon) 30C>T;264_265ins201 n/a
3 TRCN0000479579 TAAAGGTGGATGTAGGACAGGTCA pLX_317 23.3% 86.3% 1.1% V5 (not translated due to prior stop codon) 30C>T;264_265ins201 n/a
Download CSV