Transcript: Human NM_001184957.2

Homo sapiens chromosome 3 open reading frame 20 (C3orf20), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
C3orf20 (84077)
Length:
2784
CDS:
275..2623

Additional Resources:

NCBI RefSeq record:
NM_001184957.2
NBCI Gene record:
C3orf20 (84077)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417025 CTCTGGAAACGTCGCTGTATG pLKO_005 1075 CDS 100% 10.800 15.120 N C3orf20 n/a
2 TRCN0000166352 CTTCCGGTCTCAACAGGATTA pLKO.1 2344 CDS 100% 10.800 15.120 N C3orf20 n/a
3 TRCN0000160028 CAAGTTTCATTACACCTTCTA pLKO.1 1027 CDS 100% 4.950 6.930 N C3orf20 n/a
4 TRCN0000160641 CCAAGCTTCTATAATAAACCA pLKO.1 2722 3UTR 100% 3.000 2.400 N C3orf20 n/a
5 TRCN0000417199 AGGAGTTGTGTCGCCACATAG pLKO_005 768 CDS 100% 10.800 7.560 N C3orf20 n/a
6 TRCN0000418240 GATGGCTCCTCCTTCGTTTAC pLKO_005 1049 CDS 100% 10.800 7.560 N C3orf20 n/a
7 TRCN0000165217 GCTGAGATCAAGAAGCGGTTT pLKO.1 1532 CDS 100% 4.050 2.835 N C3orf20 n/a
8 TRCN0000160477 CTTCAAGTTTCATTACACCTT pLKO.1 1024 CDS 100% 2.640 1.848 N C3orf20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04325 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04325 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470196 CGTCAGGCTCCCCTGTCCCTCTAC pLX_317 12.2% 100% 100% V5 n/a
Download CSV