Transcript: Human NM_001190412.2

Homo sapiens rabphilin 3A like (without C2 domains) (RPH3AL), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RPH3AL (9501)
Length:
2632
CDS:
309..1169

Additional Resources:

NCBI RefSeq record:
NM_001190412.2
NBCI Gene record:
RPH3AL (9501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298647 GGCTATCTCCGTTGCTATATT pLKO_005 1521 3UTR 100% 15.000 21.000 N RPH3AL n/a
2 TRCN0000059867 AGGGACCGGAAAGGCGACAAA pLKO.1 912 CDS 100% 1.650 2.310 N RPH3AL n/a
3 TRCN0000298245 AGGGACCGGAAAGGCGACAAA pLKO_005 912 CDS 100% 1.650 2.310 N RPH3AL n/a
4 TRCN0000298645 TAGAGGACAGACTCCCATCCA pLKO_005 883 CDS 100% 2.640 1.848 N RPH3AL n/a
5 TRCN0000059865 CCTGGGCAGCTCGTCGGTGTT pLKO.1 620 CDS 100% 0.000 0.000 N RPH3AL n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2007 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2007 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07431 pDONR223 100% 99.8% 99.6% None 254G>A n/a
2 ccsbBroad304_07431 pLX_304 0% 99.8% 99.6% V5 254G>A n/a
3 TRCN0000477833 CTCAGGATAACCTCTGATATCCAA pLX_317 29.2% 99.8% 99.6% V5 254G>A n/a
4 ccsbBroadEn_02176 pDONR223 100% 90.7% 90.7% None 349_350ins87 n/a
5 ccsbBroad304_02176 pLX_304 0% 90.7% 90.7% V5 349_350ins87 n/a
6 TRCN0000469660 GCCGCCTCGGATATTAGTTAGCCG pLX_317 31.5% 90.7% 90.7% V5 349_350ins87 n/a
Download CSV