Transcript: Mouse NM_001195025.1

Mus musculus NUAK family, SNF1-like kinase, 2 (Nuak2), transcript variant A, mRNA.

Source:
NCBI, updated 2019-04-13
Taxon:
Mus musculus (mouse)
Gene:
Nuak2 (74137)
Length:
3132
CDS:
106..2025

Additional Resources:

NCBI RefSeq record:
NM_001195025.1
NBCI Gene record:
Nuak2 (74137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024272 CCGAGGCGATCTGTATGATTA pLKO.1 540 CDS 100% 13.200 18.480 N Nuak2 n/a
2 TRCN0000361872 TTTGACGGGCAGGATCATAAA pLKO_005 889 CDS 100% 13.200 18.480 N Nuak2 n/a
3 TRCN0000024273 GTCGCCTAAACCTCTGATGAA pLKO.1 204 CDS 100% 4.950 6.930 N Nuak2 n/a
4 TRCN0000378409 GAAGTCTCGACAGCGTGAATC pLKO_005 1500 CDS 100% 10.800 8.640 N Nuak2 n/a
5 TRCN0000024270 CCGAAAGGCATTCTCAAGAAA pLKO.1 1360 CDS 100% 5.625 4.500 N Nuak2 n/a
6 TRCN0000361873 GTGTAGTGACTGCCATTATTT pLKO_005 2358 3UTR 100% 15.000 10.500 N Nuak2 n/a
7 TRCN0000378457 GGGCTCATCAAGTCGCCTAAA pLKO_005 193 CDS 100% 10.800 7.560 N Nuak2 n/a
8 TRCN0000024269 CCCAAGGAAAGGCATCCTTAA pLKO.1 1479 CDS 100% 1.080 0.756 N Nuak2 n/a
9 TRCN0000024271 GCCAATGGAAACATCAAGATT pLKO.1 694 CDS 100% 5.625 3.375 N Nuak2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09084 pDONR223 100% 82.7% 84.6% None (many diffs) n/a
2 ccsbBroad304_09084 pLX_304 0% 82.7% 84.6% V5 (many diffs) n/a
3 TRCN0000480236 GTCTCTATGCAATAGGTCCACTGT pLX_317 17.5% 82.7% 84.6% V5 (many diffs) n/a
4 ccsbBroadEn_15176 pDONR223 0% 82.7% 84.6% None (many diffs) n/a
5 ccsbBroad304_15176 pLX_304 0% 82.7% 84.6% V5 (many diffs) n/a
6 TRCN0000470541 TATAGAGTAGCGGTCTTGGTCACC pLX_317 17.5% 82.7% 84.6% V5 (many diffs) n/a
7 TRCN0000488325 TTAGGGTACAACCTATTAATGCGC pLX_317 17.6% 82.7% 84.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV