Transcript: Mouse NM_001195047.1

Mus musculus p21 protein (Cdc42/Rac)-activated kinase 3 (Pak3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Pak3 (18481)
Length:
8197
CDS:
28..1725

Additional Resources:

NCBI RefSeq record:
NM_001195047.1
NBCI Gene record:
Pak3 (18481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148181 CTTACTTACAGTGAATTCCC pXPR_003 CGG 268 16% 2 0.7889 Pak3 PAK3 75679
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025155 CGCCGCAAAGGAAGCAATTAA pLKO.1 1689 CDS 100% 15.000 21.000 N Pak3 n/a
2 TRCN0000321996 CGCCGCAAAGGAAGCAATTAA pLKO_005 1689 CDS 100% 15.000 21.000 N Pak3 n/a
3 TRCN0000025156 CGGTCAACAACCAGAAATATA pLKO.1 482 CDS 100% 15.000 12.000 N Pak3 n/a
4 TRCN0000321995 CGGTCAACAACCAGAAATATA pLKO_005 482 CDS 100% 15.000 12.000 N Pak3 n/a
5 TRCN0000321925 TACTCCAAACCTCCAACATAA pLKO_005 392 CDS 100% 13.200 10.560 N Pak3 n/a
6 TRCN0000322016 GCAATGTCGAAGTAGCCATTA pLKO_005 1930 3UTR 100% 10.800 7.560 N Pak3 n/a
7 TRCN0000195548 CAGACTTTGAGCATACGATTC pLKO.1 248 CDS 100% 6.000 4.200 N PAK3 n/a
8 TRCN0000025158 GCAAAGTAAACGAAGCACTAT pLKO.1 1335 CDS 100% 4.950 3.465 N Pak3 n/a
9 TRCN0000350661 GCAAAGTAAACGAAGCACTAT pLKO_005 1335 CDS 100% 4.950 3.465 N Pak3 n/a
10 TRCN0000199531 GTCAGCTGTATTCCGTGACTT pLKO.1 1554 CDS 100% 4.950 3.465 N PAK3 n/a
11 TRCN0000003242 GAACAGAAGAAGAACCCACAA pLKO.1 421 CDS 100% 4.050 2.430 N PAK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487953 TCCTACCTGGTACCGTAATCTGCC pLX_317 18.5% 88.9% 94.8% V5 (many diffs) n/a
2 TRCN0000488201 GCCAGAGTTGTTACTGTGATCTCG pLX_317 18.7% 88.9% 94.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14728 pDONR223 99.6% 87.4% 41.5% None (many diffs) n/a
4 ccsbBroad304_14728 pLX_304 0% 87.4% 41.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV