Transcript: Mouse NM_001195049.1

Mus musculus p21 protein (Cdc42/Rac)-activated kinase 3 (Pak3), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Pak3 (18481)
Length:
8616
CDS:
510..2144

Additional Resources:

NCBI RefSeq record:
NM_001195049.1
NBCI Gene record:
Pak3 (18481)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025155 CGCCGCAAAGGAAGCAATTAA pLKO.1 2108 CDS 100% 15.000 21.000 N Pak3 n/a
2 TRCN0000321996 CGCCGCAAAGGAAGCAATTAA pLKO_005 2108 CDS 100% 15.000 21.000 N Pak3 n/a
3 TRCN0000025156 CGGTCAACAACCAGAAATATA pLKO.1 901 CDS 100% 15.000 12.000 N Pak3 n/a
4 TRCN0000321995 CGGTCAACAACCAGAAATATA pLKO_005 901 CDS 100% 15.000 12.000 N Pak3 n/a
5 TRCN0000321925 TACTCCAAACCTCCAACATAA pLKO_005 811 CDS 100% 13.200 10.560 N Pak3 n/a
6 TRCN0000322016 GCAATGTCGAAGTAGCCATTA pLKO_005 2349 3UTR 100% 10.800 7.560 N Pak3 n/a
7 TRCN0000195548 CAGACTTTGAGCATACGATTC pLKO.1 730 CDS 100% 6.000 4.200 N PAK3 n/a
8 TRCN0000025158 GCAAAGTAAACGAAGCACTAT pLKO.1 1754 CDS 100% 4.950 3.465 N Pak3 n/a
9 TRCN0000350661 GCAAAGTAAACGAAGCACTAT pLKO_005 1754 CDS 100% 4.950 3.465 N Pak3 n/a
10 TRCN0000199531 GTCAGCTGTATTCCGTGACTT pLKO.1 1973 CDS 100% 4.950 3.465 N PAK3 n/a
11 TRCN0000003242 GAACAGAAGAAGAACCCACAA pLKO.1 840 CDS 100% 4.050 2.430 N PAK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487953 TCCTACCTGGTACCGTAATCTGCC pLX_317 18.5% 92.3% 98.5% V5 (many diffs) n/a
2 TRCN0000488201 GCCAGAGTTGTTACTGTGATCTCG pLX_317 18.7% 92.3% 98.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14728 pDONR223 99.6% 90.8% 43.1% None (many diffs) n/a
4 ccsbBroad304_14728 pLX_304 0% 90.8% 43.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV