Transcript: Mouse NM_001195497.1

Mus musculus doublecortin-like kinase 2 (Dclk2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dclk2 (70762)
Length:
4044
CDS:
715..2982

Additional Resources:

NCBI RefSeq record:
NM_001195497.1
NBCI Gene record:
Dclk2 (70762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145364 TTTATTCAGAAGGATCCGCA pXPR_003 CGG 634 28% 2 0.1154 Dclk2 DCLK2 75698
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195497.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361787 CGGCAACTTCGCGGTAGTTAA pLKO_005 1914 CDS 100% 13.200 18.480 N Dclk2 n/a
2 TRCN0000361788 GAAATGCATTGGACGAATTAG pLKO_005 3343 3UTR 100% 13.200 18.480 N Dclk2 n/a
3 TRCN0000024268 CCTCCAACGAACCATTTCGTA pLKO.1 1154 CDS 100% 0.300 0.420 N Dclk2 n/a
4 TRCN0000024267 CCGAGGTTACAGGTAAACTAA pLKO.1 2696 CDS 100% 5.625 4.500 N Dclk2 n/a
5 TRCN0000024266 GCCAAGGAGTTAATCAGTCAA pLKO.1 2578 CDS 100% 4.950 3.960 N Dclk2 n/a
6 TRCN0000361789 AGACTCTGCCAAGGAGTTAAT pLKO_005 2571 CDS 100% 13.200 9.240 N Dclk2 n/a
7 TRCN0000361848 GAGCCTCAGCTGCGAAGTATT pLKO_005 1601 CDS 100% 13.200 9.240 N Dclk2 n/a
8 TRCN0000356265 TGACTTTGTCCTGGATCATAG pLKO_005 1548 CDS 100% 10.800 7.560 N DCLK2 n/a
9 TRCN0000024265 GCTGGTGTGATTACATACATA pLKO.1 2437 CDS 100% 5.625 3.938 N Dclk2 n/a
10 TRCN0000024264 CCCAAGTTAGTGACTGTGATT pLKO.1 1297 CDS 100% 4.950 3.465 N Dclk2 n/a
11 TRCN0000001972 TCAGTCAAATGCTTCAGGTAA pLKO.1 2591 CDS 100% 4.950 3.465 N DCLK2 n/a
12 TRCN0000350418 AGTCAAATGCTTCAGGTAAAT pLKO_005 2593 CDS 100% 13.200 9.240 N DCLK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195497.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15276 pDONR223 0% 82.5% 87.9% None (many diffs) n/a
2 ccsbBroad304_15276 pLX_304 0% 82.5% 87.9% V5 (many diffs) n/a
3 ccsbBroadEn_14422 pDONR223 100% 82.5% .3% None (many diffs) n/a
4 ccsbBroad304_14422 pLX_304 0% 82.5% .3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000475901 AACTGCGCTTGTTTCCCTCCGCCA pLX_317 14.8% 82.5% .3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV