Transcript: Human NM_001197027.1

Homo sapiens pleckstrin homology domain containing A8 (PLEKHA8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-23
Taxon:
Homo sapiens (human)
Gene:
PLEKHA8 (84725)
Length:
2147
CDS:
403..1782

Additional Resources:

NCBI RefSeq record:
NM_001197027.1
NBCI Gene record:
PLEKHA8 (84725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001197027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147355 GCAGTCTGTGAAATTCAAGTT pLKO.1 541 CDS 100% 4.950 2.970 N PLEKHA8 n/a
2 TRCN0000146652 CAAATGGCAGTCTGTGAAATT pLKO.1 535 CDS 100% 13.200 6.600 Y PLEKHA8 n/a
3 TRCN0000142461 GCTGAAGAGAGGTCTCAAATT pLKO.1 1623 CDS 100% 13.200 6.600 Y PLEKHA8P1 n/a
4 TRCN0000141697 CAGAAGCATTCTTGGCATCAT pLKO.1 1397 CDS 100% 4.950 2.475 Y PLEKHA8P1 n/a
5 TRCN0000105583 CCTGTTAAGATGGATCTTGTT pLKO.1 1468 CDS 100% 4.950 2.475 Y Plekha8 n/a
6 TRCN0000146717 CCTGTTAAGATGGATCTTGTT pLKO.1 1468 CDS 100% 4.950 2.475 Y PLEKHA8 n/a
7 TRCN0000141893 GCAGCATATCAAGTGAGGAAA pLKO.1 1157 CDS 100% 4.950 2.475 Y PLEKHA8P1 n/a
8 TRCN0000147293 GTGGTTCCAGTATTAGACAAA pLKO.1 1426 CDS 100% 4.950 2.475 Y PLEKHA8 n/a
9 TRCN0000140797 GTTAGGAACTCAGCGACTGAA pLKO.1 1591 CDS 100% 4.950 2.475 Y PLEKHA8P1 n/a
10 TRCN0000139466 CCTACAGTGTTTGCTCCTGTT pLKO.1 1453 CDS 100% 4.050 2.025 Y PLEKHA8P1 n/a
11 TRCN0000144082 CCCAACTTTCTTTAGTACCAT pLKO.1 1326 CDS 100% 3.000 1.500 Y PLEKHA8P1 n/a
12 TRCN0000149993 CCCAACTTTCTTTAGTACCAT pLKO.1 1326 CDS 100% 3.000 1.500 Y PLEKHA8 n/a
13 TRCN0000139071 CAGAAGATAGTGCTGCACGAA pLKO.1 1549 CDS 100% 2.640 1.320 Y PLEKHA8P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001197027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14314 pDONR223 100% 95.2% 95.2% None (many diffs) n/a
2 ccsbBroad304_14314 pLX_304 0% 95.2% 95.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000470965 ATATCTTGGGGATCAGTCCGGGCA pLX_317 33% 95.2% 95.2% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_10505 pDONR223 100% 65.8% 65% None (many diffs) n/a
5 TRCN0000492207 GAGGTCTCTGCGTGAGTACTCCCC pLX_317 34.1% 65.8% 65% V5 (many diffs) n/a
Download CSV