Transcript: Human NM_001199319.1

Homo sapiens peroxisomal biogenesis factor 26 (PEX26), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PEX26 (55670)
Length:
3946
CDS:
210..980

Additional Resources:

NCBI RefSeq record:
NM_001199319.1
NBCI Gene record:
PEX26 (55670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285361 ATGGAGCCTTGGCAGAATTTC pLKO_005 676 CDS 100% 13.200 9.240 N PEX26 n/a
2 TRCN0000275423 CTTCAGGTCAGGATGTTAATG pLKO_005 1311 3UTR 100% 13.200 9.240 N PEX26 n/a
3 TRCN0000285360 TGGATCCGGAAGGCTGCATTT pLKO_005 927 CDS 100% 10.800 7.560 N PEX26 n/a
4 TRCN0000157156 GAAATGGATCGGTGGCAAGAA pLKO.1 492 CDS 100% 4.950 3.465 N PEX26 n/a
5 TRCN0000157294 CAGTATTACCAGGTCCCTGAA pLKO.1 531 CDS 100% 4.050 2.835 N PEX26 n/a
6 TRCN0000157635 CTGGATGTACTTCAGGCCATT pLKO.1 786 CDS 100% 4.050 2.835 N PEX26 n/a
7 TRCN0000275422 CTGGATGTACTTCAGGCCATT pLKO_005 786 CDS 100% 4.050 2.835 N PEX26 n/a
8 TRCN0000156439 CTGGGTCCTTCAGTATTACCA pLKO.1 521 CDS 100% 3.000 1.800 N PEX26 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1421 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1422 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2864 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2864 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08564 pDONR223 100% 83.9% 83.9% None 665_666ins147 n/a
2 ccsbBroad304_08564 pLX_304 0% 83.9% 83.9% V5 665_666ins147 n/a
3 ccsbBroadEn_15908 pDONR223 0% 83.8% 83.6% None 665_666ins147;764G>A n/a
4 ccsbBroad304_15908 pLX_304 0% 83.8% 83.6% V5 665_666ins147;764G>A n/a
Download CSV