Transcript: Human NM_001204747.2

Homo sapiens replication factor C subunit 1 (RFC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RFC1 (5981)
Length:
4873
CDS:
122..3568

Additional Resources:

NCBI RefSeq record:
NM_001204747.2
NBCI Gene record:
RFC1 (5981)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365188 ATACTCACTTCAAGCTATAAA pLKO_005 3343 CDS 100% 15.000 12.000 N RFC1 n/a
2 TRCN0000370367 TTGCTTGGAAGGCCTTATATT pLKO_005 1336 CDS 100% 15.000 12.000 N RFC1 n/a
3 TRCN0000365189 ACCTCGCTCAAGACCATAATT pLKO_005 1898 CDS 100% 15.000 10.500 N RFC1 n/a
4 TRCN0000365187 CATCTGTCCAAGCCAATTTAA pLKO_005 876 CDS 100% 15.000 10.500 N RFC1 n/a
5 TRCN0000370312 ATGTGGTGTGCACGAAGTAAA pLKO_005 2579 CDS 100% 13.200 9.240 N RFC1 n/a
6 TRCN0000022037 CCTCCAGCTATGAATGAAATA pLKO.1 2510 CDS 100% 13.200 9.240 N RFC1 n/a
7 TRCN0000022038 CGCACTAATTATCAAGCTTAT pLKO.1 1247 CDS 100% 10.800 7.560 N RFC1 n/a
8 TRCN0000370313 GGGTATGAGCAGTAGGCTTAT pLKO_005 3723 3UTR 100% 10.800 7.560 N RFC1 n/a
9 TRCN0000022034 CCGGAGTAAGAGCAGTTTGAA pLKO.1 2161 CDS 100% 5.625 3.938 N RFC1 n/a
10 TRCN0000022035 CCTGTTACATACATTTCAGAA pLKO.1 428 CDS 100% 4.950 3.465 N RFC1 n/a
11 TRCN0000022036 GCCAAGCAATTACAGCTTGAT pLKO.1 731 CDS 100% 0.495 0.347 N RFC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11097 pDONR223 100% 99.9% 100% None 2544A>G n/a
2 ccsbBroad304_11097 pLX_304 0% 99.9% 100% V5 2544A>G n/a
3 TRCN0000489957 ACTCGTGTGTTCACGGGGATTATG pLX_317 4.5% 99.8% 99.9% V5 (not translated due to prior stop codon) 1885_1887delGCA;2544A>G;3135T>C n/a
4 TRCN0000488550 ACAAAGGATCGCCTTATCAACCCG pLX_317 9.3% 99.8% 99.8% V5 (many diffs) n/a
Download CSV