Transcript: Human NM_001206709.2

Homo sapiens protein kinase AMP-activated non-catalytic subunit gamma 1 (PRKAG1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
PRKAG1 (5571)
Length:
1684
CDS:
37..1059

Additional Resources:

NCBI RefSeq record:
NM_001206709.2
NBCI Gene record:
PRKAG1 (5571)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147362 GCAGCGATGAGACTTCATGA pXPR_003 AGG 97 9% 3 1.0153 PRKAG1 PRKAG1 77747
2 BRDN0001149526 TTTGATACGTCCCTGCAGGT pXPR_003 GGG 167 16% 3 0.8601 PRKAG1 PRKAG1 77746
3 BRDN0001149027 CTTCTTACTATCCCATAAAG pXPR_003 GGG 220 22% 4 0.6717 PRKAG1 PRKAG1 77748
4 BRDN0001147838 CAGAGCCACATAGACGGGGG pXPR_003 TGG 661 65% 9 -0.3506 PRKAG1 PRKAG1 77745
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195186 CCTAGATGTATCTGTGACTAA pLKO.1 834 CDS 100% 4.950 6.930 N PRKAG1 n/a
2 TRCN0000194831 CGTGTATACTTCCTTCATGAA pLKO.1 117 CDS 100% 4.950 6.930 N PRKAG1 n/a
3 TRCN0000003114 CCCAGAATCAGGCAATACTTT pLKO.1 534 CDS 100% 5.625 4.500 N PRKAG1 n/a
4 TRCN0000195237 CCATCACTGATTTCATCAATA pLKO.1 323 CDS 100% 13.200 9.240 N PRKAG1 n/a
5 TRCN0000195386 CTCTGGAAGAGCTACAGATTG pLKO.1 638 CDS 100% 10.800 7.560 N PRKAG1 n/a
6 TRCN0000197146 GCCAGTTATTGACCCAGAATC pLKO.1 522 CDS 100% 10.800 7.560 N PRKAG1 n/a
7 TRCN0000003115 CTACCCTTACCCTCACACATA pLKO.1 1238 3UTR 100% 4.950 3.465 N PRKAG1 n/a
8 TRCN0000003111 GCTTGTCTGCATTTCTCCTAA pLKO.1 447 CDS 100% 4.950 3.465 N PRKAG1 n/a
9 TRCN0000003112 GCTTTGGTGACTAACGGTGTA pLKO.1 223 CDS 100% 4.050 2.835 N PRKAG1 n/a
10 TRCN0000003113 CCCAGAATCCAACAATAGCGT pLKO.1 99 CDS 100% 0.750 0.525 N PRKAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01279 pDONR223 100% 97.3% 97.3% None 250_276del n/a
2 ccsbBroad304_01279 pLX_304 0% 97.3% 97.3% V5 250_276del n/a
3 TRCN0000469241 CGTTTCCAGAGTTCACATCTGGTT pLX_317 39.8% 97.3% 97.3% V5 250_276del n/a
4 ccsbBroadEn_14783 pDONR223 0% 97.3% 97.3% None 250_276del n/a
5 ccsbBroad304_14783 pLX_304 0% 97.3% 97.3% V5 250_276del n/a
6 TRCN0000473792 TGATCGGGTGAATCCCGAGTAAAG pLX_317 51.5% 97.3% 97.3% V5 250_276del n/a
Download CSV