Transcript: Human NM_001242309.1

Homo sapiens pitrilysin metallopeptidase 1 (PITRM1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PITRM1 (10531)
Length:
3198
CDS:
63..2882

Additional Resources:

NCBI RefSeq record:
NM_001242309.1
NBCI Gene record:
PITRM1 (10531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310116 CCGGACATCACCGACACATTT pLKO_005 969 CDS 100% 13.200 18.480 N PITRM1 n/a
2 TRCN0000052241 CGGTGAATTACGTGGGTGAAT pLKO.1 2353 CDS 100% 4.950 6.930 N PITRM1 n/a
3 TRCN0000052240 CCAGCGTTGAAAGTTTCCGAT pLKO.1 1638 CDS 100% 2.640 3.696 N PITRM1 n/a
4 TRCN0000296025 TACACCTCCGAGCTGAATATG pLKO_005 2921 3UTR 100% 13.200 9.240 N PITRM1 n/a
5 TRCN0000052242 CCCAAGCAATGCTAGGTTCTT pLKO.1 743 CDS 100% 4.950 3.465 N PITRM1 n/a
6 TRCN0000288803 CCCAAGCAATGCTAGGTTCTT pLKO_005 743 CDS 100% 4.950 3.465 N PITRM1 n/a
7 TRCN0000052238 GCACGTTTGATGACTGCCAAA pLKO.1 2427 CDS 100% 4.050 2.835 N PITRM1 n/a
8 TRCN0000288804 GCACGTTTGATGACTGCCAAA pLKO_005 2427 CDS 100% 4.050 2.835 N PITRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15717 pDONR223 0% 89.8% 88.5% None (many diffs) n/a
2 ccsbBroad304_15717 pLX_304 0% 89.8% 88.5% V5 (many diffs) n/a
3 TRCN0000471723 AACCCAGACTCCGGGTGATACACA pLX_317 11.7% 89.8% 88.5% V5 (many diffs) n/a
4 TRCN0000478736 ACCTAGGCACAACGCTACTCATCA pLX_317 28.9% 46.5% 46.4% V5 (many diffs) n/a
5 ccsbBroadEn_11517 pDONR223 100% 46.4% 46.4% None (many diffs) n/a
6 ccsbBroad304_11517 pLX_304 0% 46.4% 46.4% V5 (many diffs) n/a
Download CSV