Transcript: Human NM_001242676.2

Homo sapiens adenosylhomocysteinase like 1 (AHCYL1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
AHCYL1 (10768)
Length:
4028
CDS:
515..1966

Additional Resources:

NCBI RefSeq record:
NM_001242676.2
NBCI Gene record:
AHCYL1 (10768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051453 GCACTGATAGAACTCTATAAT pLKO.1 1766 CDS 100% 15.000 21.000 N AHCYL1 n/a
2 TRCN0000299611 GCACTGATAGAACTCTATAAT pLKO_005 1766 CDS 100% 15.000 21.000 N AHCYL1 n/a
3 TRCN0000051454 CGGCAAGTCGATGTCGTAATA pLKO.1 1466 CDS 100% 13.200 18.480 N AHCYL1 n/a
4 TRCN0000299610 CGGCAAGTCGATGTCGTAATA pLKO_005 1466 CDS 100% 13.200 18.480 N AHCYL1 n/a
5 TRCN0000303728 CAATGTCTAAATCGCCTTAAA pLKO_005 2315 3UTR 100% 13.200 10.560 N AHCYL1 n/a
6 TRCN0000314193 GAAGTATCCAAACGTGTTTAA pLKO_005 1090 CDS 100% 13.200 9.240 N Ahcyl1 n/a
7 TRCN0000051457 GATGTGATGTTTGGTGGGAAA pLKO.1 1289 CDS 100% 4.050 2.835 N AHCYL1 n/a
8 TRCN0000310439 GATGTGATGTTTGGTGGGAAA pLKO_005 1289 CDS 100% 4.050 2.835 N AHCYL1 n/a
9 TRCN0000051455 CCATCATTTGATGCCCACCTT pLKO.1 1865 CDS 100% 2.640 1.848 N AHCYL1 n/a
10 TRCN0000303727 GAGGGTCGTCTACTCAATTTG pLKO_005 1688 CDS 100% 13.200 7.920 N AHCYL1 n/a
11 TRCN0000051456 CAGCAGCAATTTCTGTGTGAA pLKO.1 676 CDS 100% 4.950 2.970 N AHCYL1 n/a
12 TRCN0000101597 GCTCTGATTTCACTCAGGAAA pLKO.1 758 CDS 100% 4.950 2.970 N Ahcyl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11546 pDONR223 100% 96.6% 96.6% None 0_1ins51 n/a
2 ccsbBroad304_11546 pLX_304 0% 96.6% 96.6% V5 0_1ins51 n/a
3 TRCN0000478243 TCTTTAAGGATATACCGATCACAC pLX_317 17.6% 96.6% 96.6% V5 0_1ins51 n/a
4 ccsbBroadEn_02522 pDONR223 100% 91.1% 91.1% None 0_1ins141 n/a
5 ccsbBroad304_02522 pLX_304 0% 91.1% 91.1% V5 0_1ins141 n/a
6 TRCN0000479541 CTCCGAGCAGCTAGTGTGTACACC pLX_317 23.3% 91.1% 91.1% V5 0_1ins141 n/a
7 ccsbBroadEn_02757 pDONR223 100% 62.5% 73.3% None (many diffs) n/a
8 ccsbBroad304_02757 pLX_304 0% 62.5% 73.3% V5 (many diffs) n/a
9 TRCN0000481020 AAAGACACGACGTGGTCGTCTCCA pLX_317 22% 62.5% 73.3% V5 (many diffs) n/a
Download CSV