Transcript: Human NM_001242767.1

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like (MTHFD1L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
MTHFD1L (25902)
Length:
3490
CDS:
145..3084

Additional Resources:

NCBI RefSeq record:
NM_001242767.1
NBCI Gene record:
MTHFD1L (25902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045399 GCTCTGTATAATCGGCTGGTT pLKO.1 1696 CDS 100% 2.640 2.112 N MTHFD1L n/a
2 TRCN0000229787 AGCAGTGAAGCCGAGATTATA pLKO_005 547 CDS 100% 15.000 10.500 N MTHFD1L n/a
3 TRCN0000229790 TCTGTGGAGTTTCCATTATTT pLKO_005 3321 3UTR 100% 15.000 10.500 N MTHFD1L n/a
4 TRCN0000229789 ACCGAAACAGAACAAGTTAAA pLKO_005 3052 CDS 100% 13.200 9.240 N MTHFD1L n/a
5 TRCN0000217958 GTCTGAACATCACTCACATTT pLKO_005 512 CDS 100% 13.200 9.240 N MTHFD1L n/a
6 TRCN0000045402 CAAGTGACATTGAGATTTCAA pLKO.1 1226 CDS 100% 5.625 3.938 N MTHFD1L n/a
7 TRCN0000045401 CGATTCCAGTTCCTGTATGAT pLKO.1 2707 CDS 100% 5.625 3.938 N MTHFD1L n/a
8 TRCN0000045398 GCAGAGAGTATTGGATACAAA pLKO.1 1866 CDS 100% 5.625 3.938 N MTHFD1L n/a
9 TRCN0000045400 GCCAAAGCTGTAATTGAACTT pLKO.1 754 CDS 100% 4.950 3.465 N MTHFD1L n/a
10 TRCN0000229788 GTGAGAGAGGCTGCGAGTAAA pLKO_005 2680 CDS 100% 13.200 7.920 N MTHFD1L n/a
11 TRCN0000036591 GCTGTCTATGGAGCCAAAGAT pLKO.1 2770 CDS 100% 5.625 2.813 Y LOC389737 n/a
12 TRCN0000036590 GTGGACAAGATAAGGACCATT pLKO.1 2743 CDS 100% 4.950 2.475 Y LOC389737 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11782 pDONR223 100% 74.8% 74.8% None 1_738del;2499C>G n/a
2 ccsbBroad304_11782 pLX_304 0% 74.8% 74.8% V5 1_738del;2499C>G n/a
3 TRCN0000472684 TAAATGCATCCAACAAAAACATAA pLX_317 20.9% 74.8% 74.8% V5 1_738del;2499C>G n/a
4 ccsbBroadEn_14097 pDONR223 100% 37.3% 37.2% None 1_1839del;2341A>G;2499C>G n/a
5 ccsbBroad304_14097 pLX_304 0% 37.3% 37.2% V5 1_1839del;2341A>G;2499C>G n/a
6 TRCN0000481112 TAATGATCTATAGGGTACTATCCT pLX_317 43.6% 37.3% 37.2% V5 1_1839del;2341A>G;2499C>G n/a
Download CSV