Transcript: Human NM_001243998.1

Homo sapiens Spi-B transcription factor (SPIB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
SPIB (6689)
Length:
3322
CDS:
84..599

Additional Resources:

NCBI RefSeq record:
NM_001243998.1
NBCI Gene record:
SPIB (6689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421687 ACTCTAGGTGATAGGACTTAC pLKO_005 686 3UTR 100% 10.800 15.120 N SPIB n/a
2 TRCN0000020556 CTATCAGAGGAGGAAGACTTA pLKO.1 192 CDS 100% 4.950 6.930 N SPIB n/a
3 TRCN0000436351 GATCTGAGATTTCCTAGTTAT pLKO_005 1068 3UTR 100% 13.200 9.240 N SPIB n/a
4 TRCN0000430413 AGCATTCCAGCTACCCTGATT pLKO_005 114 CDS 100% 4.950 3.465 N SPIB n/a
5 TRCN0000020555 GCCACACTTCAGCTGTCTGTA pLKO.1 58 5UTR 100% 4.950 3.465 N SPIB n/a
6 TRCN0000426283 CAAGCGCATGACCTACCAGAA pLKO_005 467 CDS 100% 4.050 2.835 N SPIB n/a
7 TRCN0000020557 GCGTCTTCTATGACCTGGACA pLKO.1 87 CDS 100% 2.640 1.848 N SPIB n/a
8 TRCN0000020554 CCTCTGGGATTTCTTTGTCAT pLKO.1 803 3UTR 100% 4.950 2.970 N SPIB n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1704 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1704 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2081 3UTR 100% 4.950 2.475 Y ORAI2 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2745 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2746 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2078 3UTR 100% 4.950 2.475 Y LOC339059 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1702 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1702 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1702 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2910 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473769 ACTGTTCTTATCACCAACAGAGGT pLX_317 67.2% 65.1% 9.7% V5 (not translated due to prior stop codon) 0_1ins58;65_66ins216 n/a
2 ccsbBroadEn_10445 pDONR223 100% 65.1% 58% None 0_1ins58;65_66ins215;511G>C n/a
Download CSV