Transcript: Human NM_001248002.2

Homo sapiens aryl hydrocarbon receptor nuclear translocator like 2 (ARNTL2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
ARNTL2 (56938)
Length:
7387
CDS:
238..2106

Additional Resources:

NCBI RefSeq record:
NM_001248002.2
NBCI Gene record:
ARNTL2 (56938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001248002.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419875 TGTCGGATAAAGAGTTGTAAA pLKO_005 1045 CDS 100% 13.200 18.480 N ARNTL2 n/a
2 TRCN0000021324 GCGCGTAAACTGGACAAACTT pLKO.1 616 CDS 100% 5.625 7.875 N ARNTL2 n/a
3 TRCN0000413633 TTGACTGGACAAAGCTTATTT pLKO_005 859 CDS 100% 15.000 10.500 N ARNTL2 n/a
4 TRCN0000418980 GTTCAACACTTGAGATCTTTA pLKO_005 655 CDS 100% 13.200 9.240 N ARNTL2 n/a
5 TRCN0000021327 CCCTTACCTATCTTCTTTCAA pLKO.1 467 CDS 100% 5.625 3.938 N ARNTL2 n/a
6 TRCN0000021326 GCCAATGGTTTAGTTTCACAA pLKO.1 1541 CDS 100% 4.950 3.465 N ARNTL2 n/a
7 TRCN0000021328 GCTGGTAGTATTGGAACAGAT pLKO.1 1732 CDS 100% 4.950 3.465 N ARNTL2 n/a
8 TRCN0000021325 GCCTCCAAATATTGTTGGAAT pLKO.1 1164 CDS 100% 0.495 0.347 N ARNTL2 n/a
9 TRCN0000166498 CGCCTGTAATCCCAGTACTTT pLKO.1 2857 3UTR 100% 5.625 2.813 Y MGC13053 n/a
10 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2896 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2896 3UTR 100% 4.050 2.025 Y ORAI2 n/a
12 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2896 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5160 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5160 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001248002.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12316 pDONR223 100% 94.5% 94.5% None 183_284del n/a
2 ccsbBroad304_12316 pLX_304 0% 94.5% 94.5% V5 183_284del n/a
3 TRCN0000477795 TCCGGCCCACACACAGCCCCTCTA pLX_317 24.4% 94.5% 94.5% V5 183_284del n/a
4 ccsbBroadEn_12315 pDONR223 100% 92.8% 92.8% None 29_30ins33;183_284del n/a
5 ccsbBroad304_12315 pLX_304 0% 92.8% 92.8% V5 29_30ins33;183_284del n/a
6 TRCN0000467883 ACACACGATGTACAGATACCTTAT pLX_317 24.1% 92.8% 92.8% V5 29_30ins33;183_284del n/a
Download CSV