Transcript: Human NM_001256120.2

Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
NAA10 (8260)
Length:
1585
CDS:
134..823

Additional Resources:

NCBI RefSeq record:
NM_001256120.2
NBCI Gene record:
NAA10 (8260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035417 CCAGATGAAATACTACTTCTA pLKO.1 211 CDS 100% 4.950 3.465 N NAA10 n/a
2 TRCN0000288746 CCAGATGAAATACTACTTCTA pLKO_005 211 CDS 100% 4.950 3.465 N NAA10 n/a
3 TRCN0000035416 CCATGGACATATCACCTCATT pLKO.1 319 CDS 100% 4.950 3.465 N NAA10 n/a
4 TRCN0000306810 CCATGGACATATCACCTCATT pLKO_005 319 CDS 100% 4.950 3.465 N NAA10 n/a
5 TRCN0000035418 GAGCCCAAATACTATGCAGAT pLKO.1 515 CDS 100% 4.050 2.835 N NAA10 n/a
6 TRCN0000035414 CCCGAGAACTACCAGATGAAA pLKO.1 200 CDS 100% 5.625 3.375 N NAA10 n/a
7 TRCN0000288748 CCCGAGAACTACCAGATGAAA pLKO_005 200 CDS 100% 5.625 3.375 N NAA10 n/a
8 TRCN0000035415 GCCATGATAGAGAACTTCAAT pLKO.1 404 CDS 100% 5.625 3.375 N NAA10 n/a
9 TRCN0000288818 GCCATGATAGAGAACTTCAAT pLKO_005 404 CDS 100% 5.625 3.375 N NAA10 n/a
10 TRCN0000114579 CCTGCATGTCAGGAAGAGTAA pLKO.1 439 CDS 100% 4.950 2.970 N Naa10 n/a
11 TRCN0000114578 CCATGGACATATCACCTCACT pLKO.1 319 CDS 100% 2.640 1.848 N Naa10 n/a
12 TRCN0000335521 CCATGGACATATCACCTCACT pLKO_005 319 CDS 100% 2.640 1.848 N Naa10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01877 pDONR223 100% 97.4% 97.4% None 161_162insGTATGTCCTGGCCAAAAT n/a
2 ccsbBroad304_01877 pLX_304 0% 97.4% 97.4% V5 161_162insGTATGTCCTGGCCAAAAT n/a
3 TRCN0000472691 TCATCGAAGGACGTCAGACTTTAA pLX_317 65.1% 97.4% 97.4% V5 161_162insGTATGTCCTGGCCAAAAT n/a
4 ccsbBroadEn_11264 pDONR223 100% 53.1% 46.3% None 161_162insGTATGTCCTGGCCAAAAT;322_367del;422_687del n/a
5 ccsbBroad304_11264 pLX_304 0% 53.1% 46.3% V5 161_162insGTATGTCCTGGCCAAAAT;322_367del;422_687del n/a
6 TRCN0000465347 GAGCAGATTCTGTGTGGGACTGTG pLX_317 84.5% 53.1% 46.3% V5 161_162insGTATGTCCTGGCCAAAAT;322_367del;422_687del n/a
Download CSV