Transcript: Human NM_001256188.1

Homo sapiens sorting nexin 12 (SNX12), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
SNX12 (29934)
Length:
2404
CDS:
143..619

Additional Resources:

NCBI RefSeq record:
NM_001256188.1
NBCI Gene record:
SNX12 (29934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219766 TGGAGAGAGATAGCAAGATTG pLKO.1 375 CDS 100% 10.800 15.120 N SNX12 n/a
2 TRCN0000438330 GCGCTACAGTGACTTTGAGTG pLKO_005 340 CDS 100% 4.050 3.240 N SNX12 n/a
3 TRCN0000148566 CTGGAGATCGACATCTTTAAT pLKO.1 230 CDS 100% 15.000 10.500 N SNX12 n/a
4 TRCN0000438520 ACCCACTGGCTCAGAATGAAC pLKO_005 528 CDS 100% 4.950 3.465 N SNX12 n/a
5 TRCN0000179189 GAGGAGTCTTTCATCGAAGAA pLKO.1 464 CDS 100% 4.950 3.465 N SNX12 n/a
6 TRCN0000443643 ACGCTGCCTACACATGTTCCT pLKO_005 547 CDS 100% 2.640 1.848 N SNX12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03110 pDONR223 100% 97.5% 97.5% None 152_153insGGTTCGCATGCG n/a
2 ccsbBroad304_03110 pLX_304 0% 97.5% 97.5% V5 152_153insGGTTCGCATGCG n/a
3 TRCN0000475351 CCCCTATCGTTTAAACGGTCATTA pLX_317 57.3% 97.5% 97.5% V5 152_153insGGTTCGCATGCG n/a
4 ccsbBroadEn_11913 pDONR223 100% 91.2% 90.1% None (many diffs) n/a
5 ccsbBroad304_11913 pLX_304 0% 91.2% 90.1% V5 (many diffs) n/a
6 TRCN0000467584 TCTCGAAAATTCCACCTATCATCG pLX_317 61.3% 91.2% 90.1% V5 (many diffs) n/a
Download CSV