Transcript: Mouse NM_001271357.1

Mus musculus folliculin (Flcn), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Flcn (216805)
Length:
3163
CDS:
222..1961

Additional Resources:

NCBI RefSeq record:
NM_001271357.1
NBCI Gene record:
Flcn (216805)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271357.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077487 CTTCAAGTCTCTTCGACACAT pLKO.1 1256 CDS 100% 4.950 6.930 N Flcn n/a
2 TRCN0000301434 CTTCAAGTCTCTTCGACACAT pLKO_005 1256 CDS 100% 4.950 6.930 N Flcn n/a
3 TRCN0000310871 AGTGGTCCCTTTGCATCAAAC pLKO_005 2122 3UTR 100% 10.800 8.640 N Flcn n/a
4 TRCN0000304275 GCCACACCTTCTTCATCAAAG pLKO_005 679 CDS 100% 10.800 7.560 N Flcn n/a
5 TRCN0000077484 CCCACTATCCTGAATAAGATT pLKO.1 1659 CDS 100% 5.625 3.938 N Flcn n/a
6 TRCN0000077486 GAATCAGAAAGTTGGGACAAT pLKO.1 1104 CDS 100% 4.950 3.465 N Flcn n/a
7 TRCN0000301435 GAATCAGAAAGTTGGGACAAT pLKO_005 1104 CDS 100% 4.950 3.465 N Flcn n/a
8 TRCN0000077483 GCTTGGAAAGATTTCCTGAAA pLKO.1 2678 3UTR 100% 4.950 3.465 N Flcn n/a
9 TRCN0000304276 CAGAGGAGGACAACGTCAAAC pLKO_005 1846 CDS 100% 10.800 6.480 N Flcn n/a
10 TRCN0000077485 CCAGGCTATATCAGTCATGAT pLKO.1 498 CDS 100% 4.950 2.970 N Flcn n/a
11 TRCN0000191401 CCCAATTAAATGTTGTCCTTT pLKO.1 3092 3UTR 100% 4.950 2.475 Y D130079A08Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271357.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05196 pDONR223 100% 51.7% 49.6% None (many diffs) n/a
2 ccsbBroad304_05196 pLX_304 0% 51.7% 49.6% V5 (many diffs) n/a
3 TRCN0000472641 TAACTCGCTGGCCTCAAAGCATTC pLX_317 39.5% 51.7% 49.6% V5 (many diffs) n/a
Download CSV