Transcript: Mouse NM_001271484.1

Mus musculus CAP-GLY domain containing linker protein family, member 4 (Clip4), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Clip4 (78785)
Length:
2228
CDS:
236..2032

Additional Resources:

NCBI RefSeq record:
NM_001271484.1
NBCI Gene record:
Clip4 (78785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180352 GCTCTCCGAGATATGGAATAT pLKO.1 1845 CDS 100% 13.200 18.480 N Clip4 n/a
2 TRCN0000340365 GGCTCATGGCATCGGTGATAT pLKO_005 589 CDS 100% 13.200 18.480 N Clip4 n/a
3 TRCN0000340439 TTTAGTTGCTCTCCGAGATAT pLKO_005 1838 CDS 100% 13.200 18.480 N Clip4 n/a
4 TRCN0000340441 ATGCCACTTGCAGCGACTTTA pLKO_005 771 CDS 100% 13.200 9.240 N Clip4 n/a
5 TRCN0000183903 CCTGCACATTGCAGCACATAA pLKO.1 805 CDS 100% 13.200 9.240 N Clip4 n/a
6 TRCN0000180826 GCAGCAAATAACAGTCACCAT pLKO.1 1655 CDS 100% 2.640 1.848 N Clip4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08954 pDONR223 100% 70.1% 74.1% None (many diffs) n/a
2 ccsbBroad304_08954 pLX_304 0% 70.1% 74.1% V5 (many diffs) n/a
3 TRCN0000467345 CTTTCTCAACCTAGGCCGGTAGAG pLX_317 14.7% 70.1% 74.1% V5 (many diffs) n/a
4 ccsbBroadEn_15989 pDONR223 0% 66.7% 70.5% None (many diffs) n/a
5 ccsbBroad304_15989 pLX_304 0% 66.7% 70.5% V5 (many diffs) n/a
Download CSV