Transcript: Human NM_001271602.1

Homo sapiens HECT and RLD domain containing E3 ubiquitin protein ligase 3 (HERC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
HERC3 (8916)
Length:
4730
CDS:
339..3137

Additional Resources:

NCBI RefSeq record:
NM_001271602.1
NBCI Gene record:
HERC3 (8916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428511 GCCCGAGCTGATCGCTTTAAA pLKO_005 1044 CDS 100% 15.000 12.000 N HERC3 n/a
2 TRCN0000432539 TGTGGAGCAAGAGGTCAATTA pLKO_005 945 CDS 100% 13.200 9.240 N HERC3 n/a
3 TRCN0000000292 AGGGTGTTATTTGAGAAGTTA pLKO.1 1374 CDS 100% 5.625 3.938 N HERC3 n/a
4 TRCN0000000293 CCAAGCACATTATACCAGTTT pLKO.1 1166 CDS 100% 4.950 3.465 N HERC3 n/a
5 TRCN0000000295 CGAGAAAGCTATGGAGTGATT pLKO.1 2565 CDS 100% 4.950 3.465 N HERC3 n/a
6 TRCN0000000294 CAAGGATAACAGGCAGGAATT pLKO.1 2630 CDS 100% 0.000 0.000 N HERC3 n/a
7 TRCN0000000291 GATGTGTTTCTGGGATTGTAT pLKO.1 3272 3UTR 100% 5.625 3.375 N HERC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11319 pDONR223 100% 23.4% 22.7% None (many diffs) n/a
2 ccsbBroad304_11319 pLX_304 0% 23.4% 22.7% V5 (many diffs) n/a
3 TRCN0000467611 TTTCGTAGGATCGCGCTAAGCAAG pLX_317 40.1% 23.4% 22.7% V5 (many diffs) n/a
Download CSV