Transcript: Human NM_001271608.1

Homo sapiens LIM and SH3 protein 1 (LASP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
LASP1 (3927)
Length:
4050
CDS:
415..1032

Additional Resources:

NCBI RefSeq record:
NM_001271608.1
NBCI Gene record:
LASP1 (3927)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419243 ACCTGCGACAGCTTGTGATTC pLKO_005 1128 3UTR 100% 10.800 15.120 N LASP1 n/a
2 TRCN0000074217 GAACTACAAGGGCTACGAGAA pLKO.1 457 CDS 100% 4.050 5.670 N LASP1 n/a
3 TRCN0000074216 CTGGATAAGTTCTGGCATAAA pLKO.1 392 5UTR 100% 13.200 9.240 N LASP1 n/a
4 TRCN0000436688 CCGAGCTCCAGAGAATCAAGA pLKO_005 560 CDS 100% 4.950 3.465 N LASP1 n/a
5 TRCN0000074213 GCAGAGAAGTTCCTTAGGTTT pLKO.1 2272 3UTR 100% 4.950 3.465 N LASP1 n/a
6 TRCN0000436350 GGCAAAGGTTTCAGCGTAGTG pLKO_005 529 CDS 100% 4.050 2.835 N LASP1 n/a
7 TRCN0000074214 GTCTGGATAAGTTCTGGCATA pLKO.1 390 5UTR 100% 4.050 2.835 N LASP1 n/a
8 TRCN0000435579 AGTCCTATGGTGGCTACAAGG pLKO_005 788 CDS 100% 4.050 2.430 N LASP1 n/a
9 TRCN0000417028 TATCCCACGGAGAAGGTGAAC pLKO_005 368 5UTR 100% 4.050 2.430 N LASP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06516 pDONR223 100% 78.1% 68.6% None (many diffs) n/a
2 ccsbBroad304_06516 pLX_304 0% 78.1% 68.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000466984 AACCGCTAGTGGTACGGCGCCTCA pLX_317 57.9% 78.1% 68.6% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_10944 pDONR223 100% 55.7% 35.9% None (many diffs) n/a
5 TRCN0000491946 AGACCAAAGTCAGACAGCACCCTC pLX_317 37.7% 55.7% 35.9% V5 (many diffs) n/a
Download CSV