Transcript: Human NM_001272049.2

Homo sapiens TNF receptor associated protein 1 (TRAP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TRAP1 (10131)
Length:
2064
CDS:
17..1972

Additional Resources:

NCBI RefSeq record:
NM_001272049.2
NBCI Gene record:
TRAP1 (10131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001272049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244473 TATACGAGAACGCCATGATTG pLKO_005 1872 CDS 100% 10.800 15.120 N TRAP1 n/a
2 TRCN0000060675 AGCAAGATCATCGGCCAGTTT pLKO.1 440 CDS 100% 4.950 6.930 N TRAP1 n/a
3 TRCN0000244474 CCGCTACACCCTGCACTATAA pLKO_005 832 CDS 100% 13.200 9.240 N TRAP1 n/a
4 TRCN0000244241 TGGTTCTGGAGTGTTTGAAAT pLKO_005 559 CDS 100% 13.200 9.240 N TRAP1 n/a
5 TRCN0000244240 CAGAGCACTCACCCTACTATG pLKO_005 1380 CDS 100% 10.800 7.560 N TRAP1 n/a
6 TRCN0000060676 GCGCTCATCAAGAAGCTGAAT pLKO.1 1802 CDS 100% 4.950 3.465 N TRAP1 n/a
7 TRCN0000060673 CGACATGAAACCGTCCATGTT pLKO.1 895 CDS 100% 0.495 0.347 N TRAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001272049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02324 pDONR223 100% 92.4% 92.4% None 87_88ins159 n/a
2 ccsbBroad304_02324 pLX_304 0% 92.4% 92.4% V5 87_88ins159 n/a
3 TRCN0000478303 GAACATGTTCCCGTTTCGAATCAC pLX_317 15.1% 92.4% 92.4% V5 87_88ins159 n/a
4 TRCN0000488380 ATTTCAGTCGATCTCTCTACCCTC pLX_317 18.7% 56.6% 54.8% V5 (not translated due to prior stop codon) 87_88ins159;1155delA;1199_1953del n/a
Download CSV