Transcript: Human NM_001272050.2

Homo sapiens thymidine kinase 2 (TK2), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TK2 (7084)
Length:
5185
CDS:
714..1220

Additional Resources:

NCBI RefSeq record:
NM_001272050.2
NBCI Gene record:
TK2 (7084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001272050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219751 TCGATTCACAGCGCAAGATAC pLKO.1 825 CDS 100% 10.800 15.120 N TK2 n/a
2 TRCN0000199783 GCGACAGACGTCGAGGTGTTA pLKO.1 639 5UTR 100% 1.650 2.310 N TK2 n/a
3 TRCN0000350979 GCGACAGACGTCGAGGTGTTA pLKO_005 639 5UTR 100% 1.650 2.310 N TK2 n/a
4 TRCN0000219750 ATCTGTGTCGAGGGCAATATT pLKO.1 579 5UTR 100% 15.000 10.500 N TK2 n/a
5 TRCN0000006393 CCTGTGTCCAAGTGGAGAAAT pLKO.1 666 5UTR 100% 13.200 9.240 N TK2 n/a
6 TRCN0000338422 CCTGTGTCCAAGTGGAGAAAT pLKO_005 666 5UTR 100% 13.200 9.240 N TK2 n/a
7 TRCN0000219752 GTCTGTTGATTTGATAGTTTA pLKO.1 944 CDS 100% 13.200 9.240 N TK2 n/a
8 TRCN0000006392 CCTGTATAGAAGTGGGAAGAT pLKO.1 860 CDS 100% 4.950 3.465 N TK2 n/a
9 TRCN0000338423 CCTGTATAGAAGTGGGAAGAT pLKO_005 860 CDS 100% 4.950 3.465 N TK2 n/a
10 TRCN0000011017 GAGACTTGTTACCAGAGGTTA pLKO.1 981 CDS 100% 4.950 3.465 N TK2 n/a
11 TRCN0000350914 GAGACTTGTTACCAGAGGTTA pLKO_005 981 CDS 100% 4.950 3.465 N TK2 n/a
12 TRCN0000197174 GCTGTAAATAGAGGTAGCAAG pLKO.1 2565 3UTR 100% 4.050 2.835 N TK2 n/a
13 TRCN0000011015 CCACATCTTCATGTGGACATT pLKO.1 1954 3UTR 100% 0.495 0.347 N TK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001272050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11189 pDONR223 100% 77.6% 77.3% None 0_1ins144;266C>A n/a
2 ccsbBroad304_11189 pLX_304 0% 77.6% 77.3% V5 0_1ins144;266C>A n/a
3 TRCN0000480376 CTCTATCCCCGCCTGTTCGCGTGC pLX_317 64.8% 77.6% 77.3% V5 0_1ins144;266C>A n/a
4 TRCN0000489689 AGCACTGAAGATCATTCCGTGCGT pLX_317 56.4% 71.7% 71.7% V5 (not translated due to prior stop codon) 0_1ins198 n/a
5 ccsbBroadEn_07070 pDONR223 100% 54.6% 54.3% None 0_1ins417;266C>A n/a
6 ccsbBroad304_07070 pLX_304 0% 54.6% 54.3% V5 0_1ins417;266C>A n/a
Download CSV