Transcript: Human NM_001276761.2

Homo sapiens tumor protein p53 (TP53), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
TP53 (7157)
Length:
2528
CDS:
257..1321

Additional Resources:

NCBI RefSeq record:
NM_001276761.2
NBCI Gene record:
TP53 (7157)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001276761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003756 CACCATCCACTACAACTACAT pLKO.1 829 CDS 100% 4.950 3.960 N TP53 n/a
2 TRCN0000342334 CACCATCCACTACAACTACAT pLKO_005 829 CDS 100% 4.950 3.960 N TP53 n/a
3 TRCN0000010814 GAGGGATGTTTGGGAGATGTA pLKO.1 1561 3UTR 100% 4.950 3.465 N TP53 n/a
4 TRCN0000342261 GAGGGATGTTTGGGAGATGTA pLKO_005 1561 3UTR 100% 4.950 3.465 N TP53 n/a
5 TRCN0000003754 TCAGACCTATGGAAACTACTT pLKO.1 197 5UTR 100% 4.950 3.465 N TP53 n/a
6 TRCN0000003753 CGGCGCACAGAGGAAGAGAAT pLKO.1 983 CDS 100% 1.650 1.155 N TP53 n/a
7 TRCN0000342335 CGGCGCACAGAGGAAGAGAAT pLKO_005 983 CDS 100% 1.650 1.155 N TP53 n/a
8 TRCN0000003755 GTCCAGATGAAGCTCCCAGAA pLKO.1 315 CDS 100% 4.050 2.430 N TP53 n/a
9 TRCN0000342259 GTCCAGATGAAGCTCCCAGAA pLKO_005 315 CDS 100% 4.050 2.430 N TP53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07088 pDONR223 100% 89.9% 89.5% None 0_1ins117;98C>G;715C>G n/a
2 ccsbBroad304_07088 pLX_304 56.1% 89.9% 89.5% V5 0_1ins117;98C>G;715C>G n/a
3 TRCN0000471908 TAATTATCACGCACCGCGGGCCAA pLX_317 41.2% 89.9% 89.5% V5 0_1ins117;98C>G;715C>G n/a
Download CSV