Transcript: Human NM_001278270.1

Homo sapiens transcriptional adaptor 3 (TADA3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TADA3 (10474)
Length:
1924
CDS:
218..1516

Additional Resources:

NCBI RefSeq record:
NM_001278270.1
NBCI Gene record:
TADA3 (10474)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276386 TTCAGTGTGCCGCATACTAAG pLKO_005 1133 CDS 100% 10.800 15.120 N TADA3 n/a
2 TRCN0000015736 CAGCCCAAGATCCAGGAATAT pLKO.1 596 CDS 100% 13.200 9.240 N TADA3 n/a
3 TRCN0000276449 CAGCCCAAGATCCAGGAATAT pLKO_005 596 CDS 100% 13.200 9.240 N TADA3 n/a
4 TRCN0000015735 CCTATGGAGGATTCTCCTATT pLKO.1 1043 CDS 100% 10.800 7.560 N TADA3 n/a
5 TRCN0000039290 CCCAAGATCCAGGAATATGAA pLKO.1 599 CDS 100% 5.625 3.938 N Tada3 n/a
6 TRCN0000287469 CCCAAGATCCAGGAATATGAA pLKO_005 599 CDS 100% 5.625 3.938 N Tada3 n/a
7 TRCN0000276385 CAAATGGCGGCAGTCTCTAGA pLKO_005 1617 3UTR 100% 4.950 3.465 N TADA3 n/a
8 TRCN0000015737 CACGACTTCAAGTCTGTGGAT pLKO.1 251 CDS 100% 2.640 1.848 N TADA3 n/a
9 TRCN0000015734 GCTGTGGCTGACAAGAAGAAA pLKO.1 866 CDS 100% 5.625 3.375 N TADA3 n/a
10 TRCN0000285552 GCTGTGGCTGACAAGAAGAAA pLKO_005 866 CDS 100% 5.625 3.375 N TADA3 n/a
11 TRCN0000015733 CCCAAGAAGCAGAAACTGGAA pLKO.1 518 CDS 100% 2.640 1.584 N TADA3 n/a
12 TRCN0000276387 CCCAAGAAGCAGAAACTGGAA pLKO_005 518 CDS 100% 2.640 1.584 N TADA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02446 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02446 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473532 CTGCATTGCTAAACTATGCTTGTC pLX_317 38.2% 99.8% 99.5% V5 1291G>A;1294G>T n/a
4 ccsbBroadEn_15713 pDONR223 0% 85.4% 85.4% None 1108_1296del n/a
5 TRCN0000472055 ACAGGACGCTACATGTCGTCCACG pLX_317 42.9% 85.4% 85.4% V5 (not translated due to prior stop codon) 1108_1296del n/a
Download CSV