Transcript: Human NM_001278323.1

Homo sapiens myelin associated oligodendrocyte basic protein (MOBP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
MOBP (4336)
Length:
703
CDS:
5..556

Additional Resources:

NCBI RefSeq record:
NM_001278323.1
NBCI Gene record:
MOBP (4336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064002 TCGGAAATACAGCATCTGTAA pLKO.1 127 CDS 100% 4.950 6.930 N MOBP n/a
2 TRCN0000063999 CCAGAAGTACTCCGAACACTT pLKO.1 49 CDS 100% 4.950 3.465 N MOBP n/a
3 TRCN0000064000 CGGCTGCTTCTACCAGAAGAA pLKO.1 151 CDS 100% 4.950 3.465 N MOBP n/a
4 TRCN0000064001 CCGTCAAAGCTTCTAGGTTCT pLKO.1 531 CDS 100% 4.050 2.835 N MOBP n/a
5 TRCN0000063998 CCTCAATTCCAAGAAGGAGAT pLKO.1 100 CDS 100% 4.050 2.430 N MOBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01027 pDONR223 100% 40.4% 38.7% None (many diffs) n/a
2 ccsbBroad304_01027 pLX_304 0% 40.4% 38.7% V5 (many diffs) n/a
3 TRCN0000467672 CTTTGCTCACATTTCAGAGTCAAA pLX_317 100% 40.4% 38.7% V5 (many diffs) n/a
Download CSV