Transcript: Human NM_001278689.2

Homo sapiens EGF domain specific O-linked N-acetylglucosamine transferase (EOGT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
EOGT (285203)
Length:
4443
CDS:
467..2050

Additional Resources:

NCBI RefSeq record:
NM_001278689.2
NBCI Gene record:
EOGT (285203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136281 GCAACCAATCTCTATCTTGAT pLKO.1 932 CDS 100% 4.950 3.960 N EOGT n/a
2 TRCN0000137682 GTCTCACTGAGTGGTCAGAAT pLKO.1 506 CDS 100% 4.950 3.960 N EOGT n/a
3 TRCN0000138248 CAACACCCAAAGTGGCCATTT pLKO.1 2006 CDS 100% 10.800 7.560 N EOGT n/a
4 TRCN0000137275 CAGCTCAACTTCAGACCTATA pLKO.1 1112 CDS 100% 10.800 7.560 N EOGT n/a
5 TRCN0000138932 GAGGAGCACATTCCCTTCTTT pLKO.1 596 CDS 100% 5.625 3.938 N EOGT n/a
6 TRCN0000135926 GACAGATTTAAGGAGGACTTT pLKO.1 977 CDS 100% 4.950 3.465 N EOGT n/a
7 TRCN0000135925 GCATGAAAGTATTCCAGTCTT pLKO.1 3379 3UTR 100% 4.950 3.465 N EOGT n/a
8 TRCN0000137993 GATCACACACAACACGGACAT pLKO.1 1708 CDS 100% 4.050 2.835 N EOGT n/a
9 TRCN0000136804 CCTAATACTCACAGCATTCCA pLKO.1 536 CDS 100% 3.000 2.100 N EOGT n/a
10 TRCN0000137236 GCCTTCTGGATTCAAGTGATT pLKO.1 2577 3UTR 100% 4.950 2.475 Y EOGT n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2746 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2998 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 2547 3UTR 100% 4.950 2.475 Y CCNJL n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2746 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05392 pDONR223 100% 83.9% 84% None 465A>G;832_1083del n/a
2 ccsbBroad304_05392 pLX_304 0% 83.9% 84% V5 465A>G;832_1083del n/a
3 TRCN0000470580 ATAGAAGACTGCCCTACCCTTCTT pLX_317 36% 83.9% 84% V5 465A>G;832_1083del n/a
Download CSV