Transcript: Mouse NM_001282083.1

Mus musculus general transcription factor II A, 2 (Gtf2a2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gtf2a2 (235459)
Length:
1186
CDS:
453..782

Additional Resources:

NCBI RefSeq record:
NM_001282083.1
NBCI Gene record:
Gtf2a2 (235459)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282083.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220191 GCTCATACAGTCTCAACAGAT pLKO.1 515 CDS 100% 4.950 3.960 N GTF2A2 n/a
2 TRCN0000280343 GCTCATACAGTCTCAACAGAT pLKO_005 515 CDS 100% 4.950 3.960 N GTF2A2 n/a
3 TRCN0000431953 CATACAGATTCTGCGATAATG pLKO_005 643 CDS 100% 13.200 9.240 N Gtf2a2 n/a
4 TRCN0000431481 GTCAGGAACAGAGTCAATTTC pLKO_005 606 CDS 100% 13.200 9.240 N Gtf2a2 n/a
5 TRCN0000434904 GTGGTTGCCTTCATAAGATTA pLKO_005 1011 3UTR 100% 13.200 9.240 N Gtf2a2 n/a
6 TRCN0000417148 ATGCGACTCTGTTCTCGTAAT pLKO_005 935 3UTR 100% 10.800 7.560 N Gtf2a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282083.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06338 pDONR223 100% 95.1% 99% None (many diffs) n/a
2 ccsbBroad304_06338 pLX_304 0% 95.1% 99% V5 (many diffs) n/a
3 TRCN0000479122 GATCCGATCTACCTAATTGTCTCC pLX_317 100% 95.1% 99% V5 (many diffs) n/a
Download CSV