Transcript: Human NM_001282282.2

Homo sapiens janus kinase and microtubule interacting protein 2 (JAKMIP2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
JAKMIP2 (9832)
Length:
8876
CDS:
271..2607

Additional Resources:

NCBI RefSeq record:
NM_001282282.2
NBCI Gene record:
JAKMIP2 (9832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229918 AGTCCTGATTTGCGAAGAAAT pLKO_005 976 CDS 100% 13.200 18.480 N JAKMIP2 n/a
2 TRCN0000218432 AGCTCTTGACCAAGCATATAT pLKO_005 2265 CDS 100% 15.000 10.500 N JAKMIP2 n/a
3 TRCN0000229919 AGAAGTTCCAAGCCAATTAAG pLKO_005 1405 CDS 100% 13.200 9.240 N JAKMIP2 n/a
4 TRCN0000229921 CTACAATATATGCTGCATTTA pLKO_005 2822 3UTR 100% 13.200 9.240 N JAKMIP2 n/a
5 TRCN0000229920 TGAACTAAGATTTCGACAATT pLKO_005 1566 CDS 100% 13.200 9.240 N JAKMIP2 n/a
6 TRCN0000172802 GCAGTCCTGATTTGCGAAGAA pLKO.1 974 CDS 100% 4.950 3.465 N JAKMIP2 n/a
7 TRCN0000172682 GCCAGGACTACAACTGTGTAT pLKO.1 2742 3UTR 100% 4.950 2.970 N JAKMIP2 n/a
8 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 5104 3UTR 100% 10.800 5.400 Y MRPS16 n/a
9 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5070 3UTR 100% 4.950 2.475 Y LOC387873 n/a
10 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 5104 3UTR 100% 10.800 5.400 Y CD3EAP n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6874 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 4297 3UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02255 pDONR223 100% 92.6% 92.1% None (many diffs) n/a
2 ccsbBroad304_02255 pLX_304 0% 92.6% 92.1% V5 (many diffs) n/a
3 TRCN0000481259 TGGACTTACAACCAGCCCTACCCT pLX_317 17.5% 92.6% 92.1% V5 (many diffs) n/a
Download CSV