Transcript: Human NM_001282447.2

Homo sapiens ADAM metallopeptidase domain 33 (ADAM33), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ADAM33 (80332)
Length:
4153
CDS:
687..3125

Additional Resources:

NCBI RefSeq record:
NM_001282447.2
NBCI Gene record:
ADAM33 (80332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282447.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427225 GTGTCTCCTACATGCAATTTC pLKO_005 3464 3UTR 100% 13.200 18.480 N ADAM33 n/a
2 TRCN0000051106 GACTCTACCGTTCACCTAGAT pLKO.1 2466 CDS 100% 4.950 6.930 N ADAM33 n/a
3 TRCN0000413628 TCTCAACCCACGAGATCTTTC pLKO_005 1168 CDS 100% 10.800 8.640 N ADAM33 n/a
4 TRCN0000051105 CAGCAGGAATGCCAGCTATTA pLKO.1 1112 CDS 100% 13.200 9.240 N ADAM33 n/a
5 TRCN0000418751 AGTACCTGGAACTGTACATTG pLKO_005 1315 CDS 100% 10.800 7.560 N ADAM33 n/a
6 TRCN0000415229 TGGTGAGAGGTAGCTCCTAAA pLKO_005 3120 CDS 100% 10.800 7.560 N ADAM33 n/a
7 TRCN0000051103 CGAAACTTGAACCACACCAAA pLKO.1 1368 CDS 100% 4.950 3.465 N ADAM33 n/a
8 TRCN0000414788 AGGATACATAGAAACCCACTA pLKO_005 956 CDS 100% 4.050 2.835 N ADAM33 n/a
9 TRCN0000440288 AGTCCAGATGCCAAGATCCTG pLKO_005 3095 CDS 100% 2.640 1.848 N ADAM33 n/a
10 TRCN0000051104 GCCACTACCAAGGGCGAGTAA pLKO.1 1027 CDS 100% 1.650 1.155 N ADAM33 n/a
11 TRCN0000051107 GCCAACTACGTGGACCAGCTT pLKO.1 1407 CDS 100% 0.880 0.616 N ADAM33 n/a
12 TRCN0000424031 CCTCTGCAAACAAACATAATT pLKO_005 3586 3UTR 100% 15.000 9.000 N ADAM33 n/a
13 TRCN0000437986 CTGCTGCTTTGCTCACAACTG pLKO_005 2012 CDS 100% 4.050 2.430 N ADAM33 n/a
14 TRCN0000445313 GACCACACCCTGTTCTTGACT pLKO_005 1341 CDS 100% 3.000 1.800 N ADAM33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282447.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12695 pDONR223 100% 85.2% 85.2% None 803_1162del n/a
2 ccsbBroad304_12695 pLX_304 0% 85.2% 85.2% V5 803_1162del n/a
3 ccsbBroadEn_12694 pDONR223 100% 10.4% 10.3% None 255_2436delinsG n/a
4 ccsbBroad304_12694 pLX_304 0% 10.4% 10.3% V5 255_2436delinsG n/a
5 TRCN0000466419 TAAAGTGCATACCCCAACCCCCTG pLX_317 100% 10.4% 10.3% V5 255_2436delinsG n/a
Download CSV