Transcript: Human NM_001282459.2

Homo sapiens complement C2 (C2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
C2 (717)
Length:
1644
CDS:
37..1023

Additional Resources:

NCBI RefSeq record:
NM_001282459.2
NBCI Gene record:
C2 (717)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371535 CCTGCCCTCAGAACGTGAATA pLKO_005 104 CDS 100% 13.200 9.240 N C2 n/a
2 TRCN0000003491 CCAACCCTACTCTTATGACTT pLKO.1 651 CDS 100% 4.950 3.465 N C2 n/a
3 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1372 3UTR 100% 4.050 2.025 Y P3H4 n/a
4 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1372 3UTR 100% 4.050 2.025 Y ORAI2 n/a
5 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1372 3UTR 100% 4.050 2.025 Y P3H4 n/a
6 TRCN0000162166 CAACATGATGAAACCCTGTAT pLKO.1 1408 3UTR 100% 4.950 2.475 Y SWSAP1 n/a
7 TRCN0000164260 CCAACATGATGAAACCCTGTA pLKO.1 1407 3UTR 100% 4.050 2.025 Y SWSAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00184 pDONR223 100% 41.3% 37.9% None (many diffs) n/a
2 ccsbBroad304_00184 pLX_304 0% 41.3% 37.9% V5 (many diffs) n/a
3 TRCN0000477131 CATACACCTCACTTATGATTTCAA pLX_317 16.8% 41.3% 37.9% V5 (many diffs) n/a
Download CSV