Transcript: Human NM_001282644.2

Homo sapiens protein kinase C theta (PRKCQ), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PRKCQ (5588)
Length:
3253
CDS:
182..2194

Additional Resources:

NCBI RefSeq record:
NM_001282644.2
NBCI Gene record:
PRKCQ (5588)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282644.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001791 CAAGGCCGAATGCTAATGAAT pLKO.1 407 CDS 100% 5.625 7.875 N PRKCQ n/a
2 TRCN0000199654 GCGAGGCTGTTAACCCTTACT pLKO.1 140 5UTR 100% 4.950 6.930 N PRKCQ n/a
3 TRCN0000197216 GTGGTCTTGATGGACGATGAT pLKO.1 1316 CDS 100% 4.950 6.930 N PRKCQ n/a
4 TRCN0000195468 CGGGCAGATGTATATCCAGAA pLKO.1 196 CDS 100% 4.050 5.670 N PRKCQ n/a
5 TRCN0000195559 CATCCTGATTGGGCATGAAAT pLKO.1 2780 3UTR 100% 13.200 9.240 N PRKCQ n/a
6 TRCN0000001794 GAACCTGAACTGAACAAAGAA pLKO.1 1154 CDS 100% 5.625 3.938 N PRKCQ n/a
7 TRCN0000001792 CATCCAAAGCTGCCACAAGTT pLKO.1 1480 CDS 100% 4.950 3.465 N PRKCQ n/a
8 TRCN0000001793 CAATAAAGACTGAGACCCGTT pLKO.1 2303 3UTR 100% 2.160 1.512 N PRKCQ n/a
9 TRCN0000197035 GCCAACCTTTGTGGCATAAAC pLKO.1 905 CDS 100% 13.200 7.920 N PRKCQ n/a
10 TRCN0000001790 CGGGAGATCAACTGGGAGGAA pLKO.1 1976 CDS 100% 0.880 0.528 N PRKCQ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282644.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06774 pDONR223 100% 94.9% 94.3% None 0_1ins106;10_11insAG n/a
2 ccsbBroad304_06774 pLX_304 0% 94.9% 94.3% V5 0_1ins106;10_11insAG n/a
3 TRCN0000481518 AATCGCTGTAAGTTTAGGCCGCAG pLX_317 15.8% 94.9% 94.3% V5 0_1ins106;10_11insAG n/a
4 ccsbBroadEn_14795 pDONR223 72.2% 94.7% 25.9% None (many diffs) n/a
5 ccsbBroad304_14795 pLX_304 0% 94.7% 25.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000471118 GATCACATAAGTACAGACCTGGCC pLX_317 15.5% 94.7% 25.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV